INTRODUCTION
Rickettsia spp., an obligate intracellular bacteria, is widely known to cause rickettsiosis on diverse vertebrate hosts including, but not limited to, human, through arthropod vectors such as tick (1). The rickettsiosis infect human and infected patient shows clinical manifestation of fever, headache, myalgia, and rash after 2 to 14 days of incubation. The rickettsiosis is also considered as hard-to-diagnose diseases due to intracellular features of Rickettsia spp. As climate change gets severe, the prevalence of pathogenic Rickettsia spp. was reported globally, and their emergence and re-emergence became more frequent (2). This study involves rickettsial samples obtained previously and preserved for future diagnostics because diagnostic accuracy was not sufficiently to differentiate the strains of Rickettsia spp.
In South Korea, the spotted fever group Rickettsia (SFGR)-relatednucleotide sequence was first identified in 2003 in Haemaphysalis longicornis (3). The detection of DNA sequences and antibodies of several SFGRs including R. japonica, R. conorii, R. akari, R. australis, and R. monacensis has been reported in South Korea (3, 4, 5, 6, 7, 8, 9, 10). R. japonica was first detected from Haemaphysalis spp. ticks and human sera in 2003 and 2004, respectively, while R. monacensis was first detected from Haemaphysalis spp. ticks in 2009 (3, 6, 9).
R. japonica and R. heilongjiangensis were identified in Japan and Far East (11). The first clinical case caused by R. japonica was identified in Japan in 1984 and was reported as Japanese spotted fever (JSF) (12, 13). Since then, R. japonica has been detected in Japan, Philippines, South Korea, and Thailand (13, 14, 15, 16). R. heilongjiangensis was first isolated from Dermacentor silvarum ticks in the Heilongjiang province of China in 1983. It was classified under the R. japonica subgroups in SFGR (17). Rickettsioses caused by R. heilongjiangensis have been reported from China, Russia, Kazakhstan, and Japan (18 , 19, 20, 21).
Ixodid ticks, especially H. longicornis and H. flava, are commonly found in South Korea (22, 23). Other tick species such as Ixodes nipponensis, Amblyomma testudinarium, Haemaphysalis phasiana, and I. turdus have also been reported in South Korea (24, 25).
H. longicornis ticks are major vectors of severe fever with thrombocytopenia syndrome (SFTS). They are widely distributed in the Asia Pacific region, China, Japan, and South Korea (26). Yun et al. reported that 12 (70.5%) out of 17 nucleotide sequences detected from H. longicornis in Korea were closely related to SFTS reported in China and Japan (27). In China, which is geographically close to South Korea, H. longicornis ticks are the main vectors for the livestock and act as carriers of Rickettsia as well as Theileria, Babesia, Ehrlichia, and Anaplasma (28).
Recently, along with climate change, novel pathogenic Rickettsia spp. have been discovered in diverse hosts and vectors from different regions of the world (29). South Korea is not an exception. In order to make rapid response against the changing landscape on emergence of novel Rickettsia spp., it is imperative to determine their transmission via molecular, genomic analyses. The purpose of this study was to investigate and characterize the new Rickettsia-relatedsequences in ticks inhabiting the two northeastern provinces of South Korea.
MATERIALS AND METHODS
Collection and identification of ticks
Ticks were collected using tick drag methods in two northeastern provinces (Gyeonggi and Gangwon) of South Korea from April 2009 to September 2009 (Supplementary Table 1 & Supplementary Fig. 1). A total of 1798 ticks were pooled (n = 204 pools, 1-35 ticks/pools), according to genus, sex, developmental stage, and collection site. Tick pools were prepared and each tick was transferred into 2 mL microcentrifuge tubes, screw-capped, and stored at -70°C.
Table 1.
Oligonucleotide primers for detection rickettsial target genes
| Target genea | Primers | Nucleotide sequences (5' → 3') | Product size (bp) | PCR condition (°C / sec) | ||
|---|---|---|---|---|---|---|
| Denaturation | Annealing | Extension | ||||
| 17 kDa | Rr17k.1p | TTTACAAAATTCTAAAAACCAT | 539 | 95 | 47 | 72 |
| Rr17k.539n | TCAATTCACAACTTGCCATT | |||||
| ompA | 190-3588F | AACAGTGAATGTAGGAGCAG | 1,651 | 94 | 50 | 72 |
| RompARm4433R | GAATTTAAGGTTACTATACCTTC | |||||
| ompB | RompB11Fc | ACCATAGTAGCMAGTTTTGCAG | 1,892 | 94 | 50 | 72 |
| RompB1902Rbc | CCGTCATTTCCAATAACTAACTC | 30 | 30 | 120 | ||
| RompB11Fc | ACCATAGTAGCMAGTTTTGCAG | 1,442 | 94 | 46 | 72 | |
| RompB1452Rbc | SGTTAACTTKACCGYTTATAACTGT | 30 | 30 | 90 | ||
| 120-607Fc | AATATCGCTGACGGTCAAGGT | 1,296 | 94 | 47 | 72 | |
| RompB1902Rbc | CCGTCATTTCCAATAACTAACTC | 30 | 30 | 80 | ||
| RompBRm11Fe | RCCATAGTRGCCAGTTKTGCAG | 1,846 | 94 | 50 | 72 | |
| RompBRm1902Rbe | CCGTMATTTCCAATAACTAACTC | 30 | 30 | 110 | ||
| RompBRm155Fce | CGAGTTACCTTAGATTCTGT | 1,612 | 94 | 40 | 72 | |
| RompBRm1766Rbce | CTCCAATAGTACCGATACC | 30 | 30 | 100 | ||
| 120-807Rbc | CCTTTTAGATTACCGCCTAA | |||||
| RompB1009Fc | ACATKGTTATACARAGTGYTAATGC | |||||
| RompBRm961Rbce | AAATTTGGTTTGTAATTGTA | |||||
| RompBRm845Fce | GTTGGTACATTTGGTACTACT | |||||
| sca4 | RrD749F | TGGTAGCATTAAAAGCTGATGG | 1,937 | 94 | 56 | 72 |
| RrD2685Rbc | TTCAGTAGAAGATTTAGTACCAAAT | 30 | 30 | 120 | ||
| RrD928Fc | ATTTATACACTTGCGGTAACAC | 1,758 | 94 | 45 | 72 | |
| RrD2685Rbc | TTCAGTAGAAGATTTAGTACCAAAT | 30 | 30 | 110 | ||
| RrD1713Fc | CTCTGAATTAAGCAATGCGGAAA | |||||
| Sca4_1500Rbc | CGCATAGCTACTGTAGCTTCAAGC | |||||
| RrDRh.Rj1826Rbc | TCTAAATTCTGCTGCATCAAT | |||||
| RrDRm1826Rbce | TCTAAATTCTGTTGCATCAAT | |||||
| Sca4_ 2230Fc | TGAAGGCAAAGGAGGTCCTG | |||||
DNA extraction
Tick samples were washed with 70% ethanol and rinsed with distilled water. Total DNA was extracted from each sample using the G spin total DNA extraction kit (iNtRON, Gyeonggi, South Korea). This DNA extraction kit was exclusively used for the DNA extraction from the whole blood, cells, tissues, and bacteria. Total genomic DNA samples were stored at -20°C before use.
nPCR for detection of rickettsial agents
Screening of tick pools for rickettsial DNA was conducted by nested PCR (nPCR) using genus-specific primers for the 17-kDa antigen gene as described previously (30, 31). Rickettsia-positive samples were subjected to the amplification of genes in the outer membrane protein A (ompA), outer membrane protein B (ompB), and surface cell antigen (sca4) by nPCR to generate amplicons for sequencing. To amplify the ompA gene, the ompA gene sequences coding the N- and C- terminal conserved regions (position 1-645 and 2829-4479 and amplicon size 645 bp and 1651 bp, respectively) were analyzed (30, 31). Details of ompA amplification (including primer sequences) are presented in Table 1. In addition, to amplify the citrate synthase gene (gltA), the primer pair (RpCS.62p, RpCS.1258n) was used as previously described (30, 31), and the primer pairs fD1 (5’-AGAGTTTGATCCTGGCTCAG-3’) and Rc16S.452n (5’-AACGTCATTATCTTCCTTGC-3’) were used to amplify the 16S rRNA gene (32).
The reaction mixture was prepared by transferring 2 μL DNA extract and 8 pmol of each primer to a tube of AccuPower® PCR premix (Bioneer Corp., Daejeon, Korea) containing 1U of Taq DNA polymerase, 250 μM each of dNTP, 50 mM of Tris-HCl (pH 8.3), 40 mM of KCl, and 1.5 mM MgCl2. The final volume was adjusted to 20 μL with distilled water. The nPCR reactions were run on VeritiTM 96-well Thermal Cycler (Applied Biosystems, Carlsbad, USA). Subsequently, the nPCR products were cleaned and prepared for sequencing using the QIAquick spin PCR purification kit (Qiagen) as described by the manufacturer.
Sequencing analysis
Primers used to sequence Rickettsia species are listed in Table 1. Sequencing was performed by Genotech Co. Ltd. (Daejeon, Korea). To obtain accurate nucleotide sequences for the 17-kDa antigen gene, ompA, ompB, and sca4, all the amplicons were sequenced bidirectionally. Sequence analyses were performed with MegAlign software (DNASTAR, London, UK). A concatenated alignment tree was constructed using the maximum likelihood (ML) method, the neighbor-joining (NJ) method, and the Tamura-Nei model (33). Phylogenetic analyses were performed using the Molecular Evolutionary Genetics Analysis 6.0 software and bootstraps were executed with 1,000 replications.
GenBank accession numbers
Sequences obtained in this study have been deposited in GenBank with accession numbers of KC888947-KC888948, KC888949-KC888950, KC888951-KC888952, KC888953-KC888954, KC888955-KC888956, and MK224716-MK224719 for 17-kDa, ompA-large part, ompA-small part, ompB, sca4, gltA and 16S rRNA, respectively.
RESULTS
Tick collection
A total of 1798 ticks were collected from two northeastern provinces of South Korea from August 2009 to September 2009. H. flava was the predominant (65.0%) tick collected followed by H. longicornis (20.9%) (Table 2). The total tick numbers by developmental stage were as follows: larvae 1,343 (74.7%), nymphs 417 (23.2%), and adults 38 (2.1%). The tick species were morphologically classified into H. flava (n = 1,169), H. longicornis (n = 376), and I. nipponensis (n = 253).
Table 2.
Numbers of ticks collected from northeastern province in South Korea
| Province | Species | Stage | No. of ticks | No. of 17-kDa | No. of ompA | No. of ompB | No. of sca4 |
|---|---|---|---|---|---|---|---|
| (No. of tested pools) | PCR positive (%)# | PCR positive (%)# | PCR positive (%)# | PCR positive (%)# | |||
| Gyeonggi | H. longicornis | Larvaa | 140 (9) | 1 (0.71) | 0 | - | 1 |
| Nymphb | 214 (49) | 15 (7.0) | 10 | 5 | 7 | ||
| Adult malec | 1 (1) | 0 | - | - | - | ||
| Adult femalec | 15 (15) | 1 (6.6) | 1 | 1 | 0 | ||
| H. flava | Larva | 254 (12) | 0 | - | - | - | |
| Nymph | 164 (39) | 2 (1.22) | 2 | 1 | 0 | ||
| Adult male | 12 (12) | 1 (8.3) | 1 | 1 | 0 | ||
| Adult female | 5 (5) | 0 | - | - | - | ||
| I. nipponensis | Larva | 93 (7) | 0 | - | - | - | |
| Nymph | 7 (5) | 3 (42.8) | 1 | 0 | 2 | ||
| Adult male | 1 (1) | 0 | - | - | - | ||
| Adult female | 1 (1) | 0 | - | - | - | ||
| Gangwon | H. longicornis | Larva | 1 (1) | 0 | - | - | - |
| Nymph | 4 (3) | 0 | - | - | - | ||
| Adult male | 0 | 0 | - | - | - | ||
| Adult female | 1 (1) | 1 (100.0) | 0 | 0 | 0 | ||
| H. flava | Larva | 708 (14) | 0 | - | - | - | |
| Nymph | 24 (7) | 0 | - | - | - | ||
| Adult male | 2 | 0 | - | - | - | ||
| Adult female | 0 | 0 | - | - | - | ||
| I. nipponensis | Larva | 147 (5) | 0 | - | - | - | |
| Nymph | 4 (3) | 1 (33.3) | 1 | 1 | 1 | ||
| Adult male | 0 | 0 | - | - | - | ||
| Adult female | 0 | 0 | - | - | - | ||
| Total | 1,798 (204) | 25 (1.39) | 16 (64.0) | 9 (36.0) | 11 (44.0) |
nPCR for screening of rickettsial agents
Twenty-five out of 204 (12.3%) tick pool samples tested positive based on PCR screening using primers specific for the rickettsial 17-kDa antigen gene. These positive samples were further assessed by nPCR to amplify ompA, ompB, and sca4 genes using gene-specific primers. Of these 25 samples, 16 (64%), 9 (36%), and 11 (44%) were positive for rickettsia species using primers of ompA, ompB, and sca4, respectively (Table 2, Supplementary Table 2).
Sequencing of rickettsial ompA, ompB, and sca4 genes
To identify Rickettsia spp. in the 17-kDa antigen-positive pooled tick samples, the ompA (small & large parts), ompB, and sca4 genes were sequenced partially. Out of 16 positive samples of ompA gene, 9 samples (results based on both small and large part) were highly similar to R. heilongjiangensis-R. japonica (98.6%-99.0%), five samples were highly similar to R. monacensis (99.1%-99.6%), and two samples showed that ompA small and large part were similar to R. rickettsii (97.4%) and Candidatus R. andeanae (97.8%), respectively (Supplementary Table 2).
The ompB gene showed high sequence similarity to R. heilongjiangensis (97.1%-98.6%)in seven samples. The sequence similarity between R. monacensis (99.8%) and R. raoultii (94.5%) was found in one sample each. In the case of sca4 gene, five samples showed high sequence similarity to R. tamurae (98.1%-99.6%), another five samples contained sequences similar to R. africae (98.4%-98.5%), and one sample carried sequences similar to R. japonica (97.6%).
Based on BLAST analysis, the detected sequences were classified into two types of Rickettsia isolates: Rickettsia sp. str. koreansis, formerly named as HlR/D91, obtained from H. longicornis and InR/D372 obtained from I. nipponensis. The sequence of ompA small part containing the 645 bp fragment from Rickettsia sp. str. koreansis showed 94.9 to 99.8% similarity with Rickettsia sp. FuJ98, R. japonica,and R. heilongjiangensis (Fig. 1) (Supplementary Table 2).The amplicon sequence of the large part of ompA of 1651 bp, derived from Rickettsia sp. str. koreansis showed 98.5 to 98.8% similarity with sequences of rickettsiae previously reported as R. heilongjiangensis (Fig. 1).The 1848 bp sequence of ompB from Rickettsia sp. str. koreansis showed97.0 to 97.9% similarity with R. heilongjiangensis, R. japonica (Fig. 1) while the 1705 bp fragment of sca4 showed 96.1 to 97.6% similarity with R. japonica and R. heilongjiangensis (Fig. 1). The sequences of ompA small and large parts derived from InR/D372 showed 99.8 to 99.9% similarity with R. monacensis (Fig. 1). Similarly, ompB sequences of InR/D372 shared 99.8% similarity with R. monacensis. On the other hand, the sequence of sca4 from InR/D372 shared 99.6% similarity with R. tamurae (Fig. 1). In addition, the nucleotide sequences of the gltA gene and the 16S rRNA gene were analyzed and compared with representative sequences. The nucleotide sequences of the gltA genes, Rickettsia sp. str. koreansis and InR/D372 showed 100% sequence similarity with CandidatusR. jingxinensis (GenBank accession no. MH500217) and R. monacensis Cesa (GenBank accession no. MH589997.1), respectively. The nucleotide sequence of 16S rRNA genes, Rickettsia sp. str. koreansis and InR/D372 showed 100% sequence similarity withuncultured Rickettsia YN03 (GenBank accession no. KY433580.1) and R. monacensis 1187 ISE6 (GenBank accession no. LC388771.1), respectively. In order to confirm of phylogenetic tree, the neighbor-joining tree were generated using the Kimura’s two-parameter model (Supplementary Fig. 2).
Fig. 1
Phylogenic tree consisting of concatenated fragments of ompA (small & large, 2296 bp), ompB (1848 bp), and sca4 (1705 bp) genes from Rickettsia sp. str. koreansis (formerly named as HlR/D91) (▶) and InR/D372 (▷) between various Rickettsia species with multi-phylogenetic relationships. The evolutionary history was inferred by using ML method.
DISCUSSION
Rickettsiae with a high degree of similarity to R. japonica YH (GenBank accession number AP011533) in the ticks of Korea were identified in 2003 (3). R. japonica was detected in Korean human sera in 2004 and 2005 (4, 6, 9). R. heilongjiangensis is considered genetically similar to R. japonica but distinct enough to be classified as a new species (34). In this study, we found that the nucleic acidsof rickettsial agentswere closely related to R. heilongjiangensis-R. japonica genogroup in H. longicornis ticks and R. monacensis in I. nipponensis ticks, in two northeastern provinces of South Korea. To identify new Rickettsia molecular isolates, we used partial sequencing of the gene coding for 17-kDa protein and outer membrane protein genes (ompA, ompB, and sca4). In a previous study, we analyzed a set of PCR primers of rickettsial ompA (small and large parts) gene targeting ompA upstream and downstream of the repeat regions (30). The domain of ompA gene contains 6 to10 tandem repeat units with mostly identical sequences. The number and sequences of ompA repeat units vary with the rickettsial species except for the highly conserved region (30). The ompA, ompB,and sca4 encoding genes exhibit higher sequence variability among SFGR than the other genes such as the 17-kDa, gltA,and16S rRNA.Of course, in this study, the partial 16S rRNA and gltA sequences of the Rickettsia sp. str. koreansis showed 100% sequence similarity with Rickettsia sp. YN03, and Candidatus R. jingxinensis and Rickettsia sp. InR/D372 showed 100% sequence similarity with R. monacensis ISE6 and R. monacensis Cesa, respectively.
Rickettsia sp. str. koreansis, the ompA partial sequence, showed 99.8 to 99.9% nucleotide similarity with the corresponding sequence of R. japonica and/or R. heilongjiangensis (Supplementary Table 2). The partial ompB gene showed 97.9% similarity with R. hulinensis while the nucleotide sequence of sca4 showed 97.6% similarity with R. japonica and 97.0% similarity with R. heilongjiangensis. Recently, the partial 17-kDa and ompA sequence of Rickettsia sp. str. koreansis showed close similarities with rickettsial isolates detected from H. longicornis in 2013 in southwestern province of South Korea (23). Furthermore, Rickettsia sp. InR/D372 showed similar nucleotide sequences with R. monacensis derived from I. nipponensis which was collected from south Jeolla province suggesting that Rickettsia sp. str. koreansis and InR/D372 exist without geographical or regional variation in South Korea (30).
Our results revealed that the small part of ompA derived from Rickettsia sp. str. koreansis was found in Rickettsia sp. FuJ98 (GenBank accession no. AF169629.1). Although the small part of ompA is no larger than 645 bp and the large part of ompA measured 1651 bp, the ompA of Rickettsia sp. FuJ98 has yet to be annotated. Moreover, Rickettsiavini, a new species detected in Ixodes arboricola has been isolated and identified in the Czech Republic, sharing 99.3% similarity with the nucleotide sequence of ompB gene from Rickettsia sp. str. koreansis(35).
New SFG rickettsiae species exhibit sequence similarity of < 98.8% for ompA, < 99.2% for ompB, and < 99.3% for sca4(17). Our study showed that the phylogenetic tree based on ompA-large part sequence, ompB,and sca4 sequences showed an independent clade (Fig. 1). Therefore, this study suggests that Rickettsia sp. str. koreansis is a new Rickettsia species, but there are some limitations. First, only a partial sequence of several genes was analyzed. Secondly, it was confirmed only in H. longicornis ticks. Therefore, in order to make a decision as a new species of Rickettsia, isolation and typing of multiple genes are required.
This study was conducted to identify various ticks in two northeastern provinces (Gangwon, Gyeonggi) of South Korea and analyze their dominant species, developmental stages, and Rickettsia genus-specific genes (ompA, ompB, and sca4). Rickettsial molecular detection closely related to various rickettsiae including R. heilongjiangensis, R. japonica, and R. monacensis were identified. Our results also suggested a potentially new species of Rickettsia sp. str. koreansis in two northeastern provinces of South Korea.
SUPPLEMENTARY DATA
Supplementary Fig. 2
Phylogenic tree representing multi-phylogenetic relationships between various Rickettsia species and ompA (small & large), ompB, and sca4 PCR product amplified from Rickettsia sp. str. koreansis (formerly named as HlR/D91) (▶) and InR/D372 (▷). The evolutionary history was inferred by using NJ method.
Supplementary Table 1.
Sampling sites for ticks
Supplementary Table 2.
Result of sequencing analysis of the PCR products
| Sample ID | Tick species |
R17k PCR results | Sequencing results | ||
|---|---|---|---|---|---|
| ompA (small / large*) | ompB | sca4 | |||
| 91 | H. longicornis | + | R. heilongjiangensis /R. japonica* | R. heilongjiangensis | R. japoncia |
| 187 | I. nipponensis | + | R. heilongjiangensis /R. japonica* | N.D | R. tamurae |
| 195 | H. longicornis | + | N.D | R. heilongjiangensis | R. africae |
| 201 | H. longicornis | + | N.D | N.D | N.D |
| 208 | H. flava | + | R. heilongjiangensis# | N.D | N.D |
| 213 | H. flava | + | R. heilongjiangensis# | R. raoultii | N.D |
| 228 | H. longicornis | + | R. japonica# | N.D | N.D |
| 230 | H. longicornis | + | R. monacensis# | N.D | N.D |
| 231 | H. longicornis | + | R. rickettsii /Can. R. andeanae* | N.D | N.D |
| 233 | H. longicornis | + | R. monacensis# | N.D | R. africae |
| 234 | H. longicornis | + | N.D / R. japonica* | R. heilongjiangensis | N.D |
| 236 | H. longicornis | + | N.D | N.D | N.D |
| 237 | H. longicornis | + | N.D | R. heilongjiangensis | N.D |
| 238 | H. longicornis | + | R. rickettsii /Can. R. andeanae* | N.D | N.D |
| 239 | H. longicornis | + | N.D | N.D | N.D |
| 240 | H. longicornis | + | R. heilongjiangensis /R. japonica* | R. heilongjiangensis | R. tamurae |
| 242 | H. longicornis | + | R. heilongjiangensis /R. japonica* | N.D | N.D |
| 243 | H. longicornis | + | R. heilongjiangensis /R. japonica* | N.D | N.D |
| 252 | H. longicornis | + | R. heilongjiangensis /R. japonica* | R. heilongjiangensis | R. africae |
| 292 | H. longicornis | + | N.D | N.D | R. africae |
| 317 | I. nipponensis | + | N.D | N.D | N.D |
| 356 | H. longicornis | + | N.D | R. heilongjiangensis | R. africae |
| 372 | I. nipponensis | + | R. monacensis# | R. monacensis | R. tamurae |
| 404 | I. nipponensis | + | R. monacensis# | N.D | R. tamurae |
| 409 | I. nipponensis | + | R. monacensis# | N.D | R. tamurae |
| Total | 25 | 16 | 9 | 11 | |
