Original Article

JOURNAL OF BACTERIOLOGY AND VIROLOGY. September 2021. 120-127
https://doi.org/10.4167/jbv.2021.51.3.120

ABSTRACT


MAIN

INTRODUCTION

Klebsiella pneumoniae, a gram-negative bacterium, is an important human opportunistic pathogen that can cause serious hospital- and community-acquired diseases, including septicemia, pneumonia, and urinary tract infections (1). The emergence and dissemination of multidrug-resistant (MDR) and extremely drug resistant (XDR) K. pneumoniae are of great health concern in many countries (1). In particular, carbapenem-resistant K. pneumoniae (CRKP) was recognized as a serious threat worldwide because the isolates often were co-resistant to most antibiotics, such as penicillins, cephalosporins, fluoroquinolones, and aminoglycosides (2). The most prevalent mechanism of resistance to carbapenems has been associated with production of carbapenem-hydrolyzing β-lactamases, including K. pneumoniae carbapenemases (KPCs) (Ambler class A), metallo-β-lactamases (MBLs) (Ambler class B), and OXA-48-like β-lactamases (Ambler class D) (2, 3). Carbapenem resistance has been conferred primarily by carbapenemase production mediated by KPCs (4). Worldwide, the predominant KPC-producing K. pneumoniae isolates are of sequence types (ST) 11 and 258; ST11 prevails mainly in East Asia, especially in China, and ST258 is most common in North America, Latin America, and several Europe countries (3, 5). In addition, some studies described how non-carbapenemase-producing CRKP(nCP-CRKP)can occur through impaired permeability via loss of outer membrane porins, OmpK35 and OmpK36, linked with AmpC-type β-lactamases (6, 7).

Infection with CRKP has limited therapeutic options, but one of the available antimicrobials is colistin, a last resort antibiotic that acts by disrupting the anionic lipopolysaccharide (LPS) component of the gram-negative outer membrane. The most common mechanism for colistin resistance in K. pneumoniae is mediated by modification of the LPS through cationic substitution (8). The LPS modification depends on a large panel of regulatory genes and operons (8, 9). Regulatory genes include those encoding proteins involved in the PmrA/PmrB system, the PhoP/PhoQ system, and a negative regulator (MgrB) of the PhoP/PhoQ system; the pmrC gene, pmrE gene, and pmrHFIJKLM operon are associated with LPS modification. Recently, plasmid-mediated colistin-resistant mcr genes were identified in Escherichia coli and K. pneumoniae(8). More worryingly, colistin-resistant KPC-producing K. pneumoniae has beenreported sporadically from Korea, Greece, North America, and other European countries in the past few years (8, 10). Therefore, the emergence and spread of colistin resistance in CRKPhave increased the importance of long-term surveillance and an approach to gain insight into the exact mechanisms responsible for the resistance.

Although a number of studies has reported the prevalence and mechanism of K. pneumoniae resistance to carbapenem or colistin, K. pneumoniae that is resistant to both antibiotics has not been well demonstrated despite the increase in colistin-resistant CRKP. In this study, we screened carbapenem-resistant, colistin-resistant K. pneumoniae in clinical isolates collected from a Korean tertiary hospital to investigate the prevalence and mechanisms of carbapenem-resistant, colistin-resistant K. pneumoniae in Korea. Two isolates with both carbapenem and colistin resistance were identified and analyzed for STs and the genes associated with resistance to these antibiotics. Although the isolates did not carry any prevalent carbapenem-hydrolyzing β-lactamase genes, such as KPCs and OXA-48-like β-lactamases, we identified mutations within the ompK35, ompK36, mgrB, and pmr genes that have not been observed in carbapenem-resistant, colistin-resistant K. pneumoniae ST11 and ST258 in Korea.

MATERIALS AND METHODS

Bacterial isolates and antimicrobial susceptibility

From 2008 to 2010 and from 2015 to 2018, 338 clinical isolates of K. pneumoniae were obtained from a tertiary hospital in Jeonbuk, Korea (Jeonbuk National University Hospital Culture Collection for Pathogens). The primary identification and antimicrobial susceptibility test were performed with a VITEK-2 system (bioMérieux, Marcy l’Etoile, France). The minimum inhibitory concentration (MIC) of antibiotics was determined by the macrodilution method using 2 ml of cation-adjusted Muller-Hinton broth in a standard glass test tube according to Clinical and Laboratory Standards Institute guidelines (8, 11). The MIC also was measured using the E-test carried out on a Muller-Hinton agar plate according to the manufacturer’s instructions (bioMérieux, Marcy l’Etoile, France; Liofilchem Inc., MA, USA). As a control, K. pneumoniae ATCC 13883 purchased from the American Type Culture Collection (ATCC, VA, USA) was used.

Multilocus sequence typing (MLST)

MLST of K. pneumoniae isolates was performed with seven housekeeping genes (gapA, infB, mdh, pgi, phoE, rpoB, and tonB), according to a previously described protocol (12). Allele sequences and ST were assigned according to Institute Pasteur’s MLST scheme for K. pneumoniae.

Analysis of antimicrobial resistance-related genes by polymerase chain reaction (PCR) amplification and sequencing

Whole-bacterial DNA was prepared from bacterial cells lysed by heating at 95°C for 10 min. The colistin resistance- associated genes (pmrA, pmrB, pmrC, pmrD, pmrE, pmrK, phoP, phoQ, and mgrB) were amplified using specific primers (Table 1) (13, 14, 15). PCR amplification detection for plasmid-mediated mcr genes was performed using previously described primers (16, 17). The presence of extended-spectrum β-lactamase and carbapenem-hydrolyzing β-lactamase genes, such as blaCTX-M, blaSHV, blaTEM, blaKPCs, and blaOXA-48, was screened as previously described (18, 19, 20). PCR analysis for the ompK35 and ompK36 genes, K. pneumoniae porin genes associated with carbapenem resistance, was carried using the following primers: ompK35 forward, 5′- GCCGCCCGCACTCCACGCTG-3′; ompK35 reverse, 5′-CAGAAAGTTATGGAGCCACG-3′; ompK36 forward, 5′-GTATCATATTCTTGTTGGATTA-3′; and ompK36 reverse, 5′-GAAAGTCATATCCATTAATCG-3′. PCR analysis was used with previously described primers to identify the genes encoding AmpC-type β-lactamases from the following six families (21): MOX (MOX-1, MOX-2, CMY-1, and CMY-8 to CMY-11), CIT (LAT-1 to LAT-4, CMY-2 to CMY-7, and BIL-1), DHA (DHA-1 and DHA-2), ACC, EBC (MIR-1T and ACT-1), and FOX (FOX-1 to FOX-5b). The amplified PCR products were confirmed by agarose gel electrophoresis, purified from the agarose gel, and sequenced. The nucleotide and deduced protein sequences were analyzed at the National Center for Biotechnology Information website (www.ncbi.nlm.nih.gov) using the Basic Local Alignment Search Tool (BLAST) program.

Table 1.

Primers for PCR amplification of the pmr, mgrB, phoP, and phoQ genes

Gene Primer direction Primer sequence Reference
pmrA Forward CATTTCCGCGCACTGTCTGC 14
Reverse CAGCTTTCAGTTGCAAACAG
pmrB Forward ACCTACGCGAAAAGATTGGC 14
Reverse GATGAGGATAGCGCCCATGC
pmrC(eptA) Forward ATGTCGTTATTGACTCTGCGTC this study
Reverse tcaaccagcctctctacatgg
pmrD Forward TAGATGCTTCATGACGCTCTCTC 12
Reverse gtgttatttgccggcgtttgtc
pmrE Forward ATGAAAATTACTATTTCCGGTAC this study
Reverse ctaatcattaccaaacagatcg
pmrK Forward cctcaggcaaagtggttc this study
Reverse gccgtccgcgacgggacg
mgrB Forward CAGCCAGCGATGCCAGATTT 13
Reverse CCTGGCGTGATTTTGACACGA
phoP Forward GAGCTTCAGACTACTATCGA 14
Reverse GGGAAGATATGCCGCAACAG
phoQ Forward ATACCCACAGGACGTCATCA 14
Reverse CAGGTGTCTGACAGGGATTA

RESULTS AND DISCUSSION

Isolation of non-carbapenemase-producing carbapenem-resistant K. pneumoniae (nCP-CRKP) with colistin resistance

CRKP has been frequently identified as multidrug-resistant (MDR), including the potential development of resistance to colistin, a last-line antibiotic, and is associated with high rates of morbidity and mortality worldwide (22). To investigate the prevalence and the detailed mechanisms of MDR K. pneumoniae with carbapenem and colitis resistance, we assessed carbapenem and colistin resistance from the K. pneumoniae isolates collected by a Korean tertiary hospital, Jeonbuk National University Hospital Culture Collection for Pathogens. Out of 338 K. pneumoniae isolates, two (0.6%) were identified as both carbapenem and colistin resistance. Interestingly, a high rate of colistin resistance in CRKP was observed as previously reported (23, 24). Two (22%) of nine CRKP possessed colistin resistance (Table 2); the colistin MIC was ≥16 μg/ml using the broth culture macrodilution method, but control K. pneumoniae ATCC13883 was not resistant to colistin. The two colistin-resistant isolates, LTH36 and LTH51, were resistant to all tested β-lactam antibiotics, including carbapenems (ertapenem, imipenem, and meropenem) and broad spectrum β-lactams (ceftazidime, cefotaxime, ciprofloxacin, and cefpirome) (Table 2). Intriguingly, the MIC (≥32 μg/ml) for imipenem was higher in the two isolates than those of most CRKP within our health system (imipenem MIC range, 1 to 4 μg/ml) (25). In addition, the isolates were resistant to aztreonam and aminoglycoside antibiotics (amikacin and gentamicin) (Table 2). However, one isolate, LTH51, remained susceptible only to tigecycline, as previously reported in other colistin-resistant K. pneumoniae, although the other isolate, LTH36, was not resistant to tigecycline and trimethoprim/sulfamethoxazole (Table 2) (22, 26).

Table 2.

Antimicrobial susceptibility profiles of carbapenem-resistant, colistin-resistant K. pneumoniae isolates

Isolate MIC (μg/ml)
ETPa IPMb MEMa CSTb AMKa GENb TGCb AZTb CAZb CTXb CIPa CPRa STXa
ATCC13883 <0.25 1 <0.25 0.5 1 <0.25 0.5 <0.25 0.25 <0.25 <0.25 <0.25 <0.25
LTH36 ≥32 ≥32 8 16 ≥256 ≥256 1 128 ≥256 ≥256 ≥32 8 0.25
LTH51 ≥32 ≥32 24 32 ≥256 ≥256 1 ≥256 ≥256 ≥256 ≥32 ≥256 ≥32

Minimum inhibitory concentration (MIC) was measured by aquantitative E-test or bbroth macrodilution assay. K. pneumoniae ATCC 13883 was used as a control strain. Antibiotic resistance was considered as an MIC of >2 μg/ml. ETP, ertapenem; IPM, imipenem; MEM, meropenem; CST, colistin; AMK, amikacin; GEN, gentamicin; TGC, tigecycline; AZT, aztreonam; CAZ, ceftazidime; CTX, cefotaxime; CIP, ciprofloxacin; CPR, cefpirome; STX, trimethoprim/sulfamethoxazole.

Since the isolates exhibited resistant phenotypes to a variety of β-lactam antibiotics, including carbapenems, we investigated the presence of extend-spectrum-β-lactamase (ESBL) and carbapenem-hydrolyzing β-lactamase genes using PCR analysis and nucleotide sequencing. For ESBL genes, blaCTX-M, blaSHV, and blaTEM genes were analyzed. The LTH36 isolate carried the blaSHV-31 and blaTEM-116 genes, and the LTH51 isolate revealed the presence of the blaCTX-M-3, blaSHV-11, and blaTEM-1 genes. For detection of genes associated with carbapenem resistance, we evaluated the most prevalent carbapenem-hydrolyzing β-lactamase genes, blaKPCs and blaOXA-48. However, the blaKPC and blaOXA-48 genes were not identified in the two isolates. Since carbapenem resistance can occur with various types of carbapenemases, we screened for other carbapenem- hydrolyzing β-lactamase genes with previously described primers to amplify the following genes (18): blaOXA-48-like including OXA-199 and OXA-370, blaVIM-type, blaNDM-1, blaIMP variants except IMP-3, 16, 27, 31, 34, and 35, blaOXA-23-like,blaSME-1 to 5, blaIMI-type, blaIMP-27, blaNDM-2 to 10 and 12, blaIMP-3 and 34, blaGES-1 to 22 and 24, blaGIM-1, blaOXA-2-, 10-, 51-, and 58-like, blaDIM-1, and blaCMY-2.Unexpectedly, the tested genes involved in carbapenem resistance were not detected in the two K. pneumoniae isolates, LTH36 and LTH51.

To investigate diversity, distribution, and relationship of our blaKPC- and blaOXA-48-negative CRKP isolates with global isolates, we performed MLST. Interestingly, the STs of our colistin-resistant CRKP isolates LTH36 and LTH51 were ST11 and ST258, respectively, which are the most global STs of KPC-producing CRKP (3, 5, 27). Although the CRKP isolates with ST11 and ST258 were previously isolated in Korea, they carried KPC and showed a different susceptibility to colistin: the ST11 exhibited a colistin-resistant phenotype, but the ST258 did not (10, 28, 29). Taken together, we first isolated K. pneumoniae ST11 and ST258 in Korea possessing both carbapenem and colistin resistance despite the absence of previously known carbapenem-hydrolyzing β-lactamase genes.

Characterization of the carbapenem resistance in the nCP-CRKP isolates with colistin-resistance

Because our two isolates were resistant to carbapenems without producing the most prevalent carbapenemases, we investigated an alternative mechanism for carbapenem resistance, which could result from mutation(s) in outer membrane major porins, OmpK35 and OmpK36, in association with AmpC-type β-lactamases. The deficiency of porin as a selective barrier would result in carbapenem resistance through reducing the permeability of porin; in addition, AmpC β-lactamases without carbapenemase activity could be involved in trapping carbapenems, which prevent the antibiotics from accessing their targets (6).

To test this possibility, we analyzed the sequences of porin genes, ompK35 and ompK36, and the presence of blaAmpC genes from six families: ACC, CIT, DHA, EBC, FOX, and MOX. In the sequence analysis of ompK35 and ompK36 compared with those of a control K. pneumoniae ATCC13883 (ompK35 and ompk36, GenBank accession no. CP040993.1), our LTH36 and LTH51 isolates revealed the lack of one or both of the two major porins. The LTH36 isolate revealed 1-bp deletion at position 54 and 1-bp insertion at position 419 of the ompK35 and ompk36 genes, respectively, which created amino acid changes and premature terminations after Gly-18 and Ser-139 in OmpK35 and OpmK36, respectively. In the LTH51 isolate, ompk36 sequencing reveled an ochre nonsense mutation after the start codon that could lead to the loss of OpmK36 porin, although there was wild type of the ompK35 gene. Furthermore, PCR and sequencing analysis of genes encoding AmpC β-lactamases showed that all of the nCP-CRKP isolates with colistin resistance harbored the DHA-1 ampC β-lactamase gene. These results suggest that the carbapenem resistance of the nCP-CRKP isolates LTH36 and LTH51 could be associated with loss of the major porins OmpK35 and/or OpmK36 and involved in DHA-1 AmpC β-lactamase production.

Characterization of the colistin resistance in the nCP-CRKP isolates with colistin resistance

To investigate the molecular mechanisms related to colistin resistance in the nCP-CRKP isolates with colistin resistance, we evaluated genetic mutations in the PmrA/PmrB and PhoP/PhoQ two-component regulatory systems, the PmrD connector of the two-component systems, the MgrB negative regulator of the PhoP/PhoQ, and LPS-modifying enzymes including PmrC, PmrE, and PmrK. Sequence analysis revealed amino acid variations in PmrB, PmrC, PmrE, PmrK, and MgrB compared with the colistin-susceptible K. pneumoniae reference strain, MGH78578 (Table 3). The same amino acid changes that were previously reported as contributing to colistin resistance were observed in PmrB (T246A and R256G) and PmrC (C27F, I138V, and Q319R) from the two isolates (8, 30, 31). Furthermore, we identified novel amino acid substitutions in PmrE (V17I, A33S, H68Q, T105A, A165E, D172N, A274G, N354D/A, E371D, and T373A) and PmrK (M114L, V117I, R372K, and G462R) from the LTH36 or LTH51 isolates, although more studies are required to prove a connection between the mutations and colistin resistance. Interestingly, although the two K. pneumoniae isolates belonged to different STs, there were the amino acid changes at the same position in PmrB, PmrC, PmrE, and PmrK: PmrB, T246A, and R256G; PmrC, C27F, I138V, and Q319R; PmrE, N354D/A and T373A; PmrK, M114L, V117I, and R372K. In the mgrB gene analysis of the two isolates, insertion sequences (ISs) were found in all isolates and caused insertional inactivation of the MgrB protein by missense and frameshift mutations, which resulted in amino acid residue and terminational changes after Leu-17 and Cys-39 of MgrB from the LTH36 and LTH51 isolates, respectively. However, PmrA, PmrD, PhoP, and PhoQ of the isolates were identical to the wild-type proteins of the reference strain K. pneumoniae MGH78578, and plasmid-mediated colistin resistance genes, mcr-1 to mcr-9, were not detected in the isolates. These results suggest that the amino acid changes in PmrB, PmrC, PmrE, PmrK, and MgrB of the colistin-resistant CRKP isolates might be associated with colistin resistance.

Table 3.

Sequence types and genetic mutations in carbapenem-resistant, colistin-resistant K. pneumoniae isolates

Isolate ST PmrB PmrC PmrE PmrK MgrB
LTH36 11 T246A, R256G C27F, I138V, Q319R V17I, A33S, H68Q, T105A, A165E, D172N, A274G, N354D, E371D, T373A M114L, V117I, R372K, G462R , Frameshift (IS)
LTH51 258 T246A, R256G C27F, I138V, Q319R N354A, T373A M114L, V117I, R372K Frameshift (IS)

The insertion sequences (ISs) were inserted after nucleotide position 51 and 117 of mgrB (GenBank accession number KF852760.1) from the LTH36 and LTH51, respectively, and were identical to the followed regions: mgrB IS of LTH36, accession no. CP066855.1, region 2271513 to 2272285; mgrB IS of LTH51, accession no. MW650888.1, region 93977 to 94744. The reference GenBank accession number for pmrA, pmrB, pmrC (eptA), pmrD, pmrE, pmrK, phoP, and phoQ gene is CP000647.1

In conclusion, we detected a high rate (22%, 2 of 9) of colistin resistance among CRKP although two (0.6%) K. pneumoniae isolates with carbapenem and colistin resistance were found in 338 clinical isolates collected by a Korean tertiary hospital. The two isolates belonged to ST11 and ST258, the most prevalent STs of KPC-producing CRKP, but these carbapenem resistances were related to truncating mutations in the major porin ompK35 and/or ompK36 genes associated with DHA-1 AmpC β-lactamase. In colistin resistance, these isolates carried novel and previously reported mutations in the pmrB, pmrC, pmrE, pmrK, and mgrB genes that could confer colistin resistance (Table 3). Taken together, we identified and characterized the detail molecular mechanisms of carbapenem and colistin resistance in K. pneumoniae ST11 and ST258 isolate that have not been reported in Korea. These results suggest that colistin-resistant nCP-CRKP with novel mutations emerged in Korea and could spread throughout the country. In addition, this study showed the importance of judicious use of antibiotics with proper susceptibility analysis as well as continuous surveillance and strict infection control measures on colistin-resistant CRKP to prevent the resistant bacteria from becoming prevalent in the hospital setting.

ABBREVIATION

KPC, K. pneumoniae carbapenemase; CRKP, carbapenem-resistant K. pneumoniae;nCP-CRKP, non-carbapenemase-producing carbapenem-resistant K. pneumoniae; MDR, multidrug-resistant; MIC, minimum inhibitory concentration; MLST, multilocus sequence typing; ST, sequence type

Acknowledgements

We thank Hyeon Ju Lee of Jeonbuk National University for her experimental assistance. The clinical isolates for this study were provided by the Jeonbuk National University Hospital as the branch of National Culture Collection for Pathogens (NCCP). This work was supported by National Research Foundation of Korea (NRF) grants (2019R1F1A1056056 and 2020M3A9G3080282) funded by the Korean government (MSIT) and the Fund of Biomedical Research Institute, Jeonbuk National University Hospital.

[CONFLICT OF INTEREST]

No potential conflict of interest relevant to this article was reported.

References

1

Navon-Venezia S, Kondratyeva K, Carattoli A. Klebsiella pneumoniae: a major worldwide source and shuttle for antibiotic resistance. FEMS Microbiol Rev 2017;41:252-75.

10.1093/femsre/fux01328521338
2

Lee CR, Lee JH, Park KS, Kim YB, Jeong BC, Lee SH. Global dissemination of carbapenemase-producing Klebsiella pneumoniae: Epidemiology, genetic context, treatment options, and detection methods. Front Microbiol 2016;7:895.

10.3389/fmicb.2016.00895
3

Pitout JD, Nordmann P, Poirel L. Carbapenemase-Producing Klebsiella pneumoniae, a key pathogen set for global nosocomial dominance. Antimicrob Agents Chemother 2015;59:5873-84.

10.1128/AAC.01019-1526169401PMC4576115
4

Munoz-Price LS, Poirel L, Bonomo RA, Schwaber MJ, Daikos GL, Cormican M, et al. Clinical epidemiology of the global expansion of Klebsiella pneumoniae carbapenemases. Lancet Infect Dis 2013;13:785-96.

10.1016/S1473-3099(13)70190-7
5

Qi Y, Wei Z, Ji S, Du X, Shen P, Yu Y. ST11, the dominant clone of KPC-producing Klebsiella pneumoniae in China. J Antimicrob Chemother 2011;66:307-12.

10.1093/jac/dkq43121131324
6

Hamzaoui Z, Ocampo-Sosa A, Fernandez Martinez M, Landolsi S, Ferjani S, Maamar E, et al. Role of association of OmpK35 and OmpK36 alteration and blaESBL and/or blaAmpC genes in conferring carbapenem resistance among non-carbapenemase-producing Klebsiella pneumoniae.Int J Antimicrob Agents 2018;52:898-905.

10.1016/j.ijantimicag.2018.03.02029621592
7

Leavitt A, Chmelnitsky I, Colodner R, Ofek I, Carmeli Y, Navon-Venezia S. Ertapenem resistance among extended- spectrum-beta-lactamase-producing Klebsiella pneumoniae isolates. J Clin Microbiol 2009;47:969-74.

10.1128/JCM.00651-0819213695PMC2668359
8

Poirel L, Jayol A, Nordmann P. Polymyxins: Antibacterial activity, susceptibility testing, and resistance mechanisms encoded by plasmids or chromosomes. Clin Microbiol Rev 2017;30:557-96.

10.1128/CMR.00064-1628275006PMC5355641
9

Groisman EA. The pleiotropic two-component regulatory system PhoP-PhoQ. J Bacteriol 2001;183:1835-42.

10.1128/JB.183.6.1835-1842.200111222580PMC95077
10

Rhee JY, Park YK, Shin JY, Choi JY, Lee MY, Peck KR, et al. KPC-producing extreme drug-resistant Klebsiella pneumoniae isolate from a patient with diabetes mellitus and chronic renal failure on hemodialysis in South Korea. Antimicrob Agents Chemother 2010;54:2278-9.

10.1128/AAC.00011-1020211897PMC2863605
11

Clinical and Laboratory Standards Institute (CLSI). Performance standards for antimicrobial susceptibility testing; 24th informational supplement. CLSI document M100-S24. Clinical and Laboratory Standards Institute, Wayne, PA, 2014.

12

Diancourt L, Passet V, Verhoef J, Grimont PA, Brisse S. Multilocus sequence typing of Klebsiella pneumoniae nosocomial isolates. J Clin Microbiol 2005;43:4178-82.

10.1128/JCM.43.8.4178-4182.200516081970PMC1233940
13

Cheng HY, Chen YF, Peng HL. Molecular characterization of the PhoPQ-PmrD-PmrAB mediated pathway regulating polymyxin B resistance in Klebsiella pneumoniae CG43. J Biomed Sci 2010;17:60.

10.1186/1423-0127-17-6020653976PMC2919465
14

Choi MJ, Kim S, Ko KS. Pathways Regulating the pbgP operon and colistin resistance in Klebsiella pneumoniae strains. J Microbiol Biotechnol 2016;26:1620-8.

10.4014/jmb.1604.0401627238937
15

Jayol A, Poirel L, Brink A, Villegas MV, Yilmaz M, Nordmann P. Resistance to colistin associated with a single amino acid change in protein PmrB among Klebsiella pneumoniae isolates of worldwide origin. Antimicrob Agents Chemother 2014;58:4762-6.

10.1128/AAC.00084-1424914122PMC4136042
16

Kieffer N, Royer G, Decousser JW, Bourrel AS, Palmieri M, Ortiz De La Rosa JM, et al. mcr-9, an inducible gene encoding an acquired phosphoethanolamine transferase in Escherichia coli, and it's origin. Antimicrob Agents Chemother 2019;63:e00965-19.

10.1128/AAC.01866-19
17

Wang X, Wang Y, Zhou Y, Li J, Yin W, Wang S, et al. Emergence of a novel mobile colistin resistance gene, mcr-8, in NDM-producing Klebsiella pneumoniae. Emerg Microbes Infect 2018;7:122.

10.1038/s41426-018-0124-z29970891PMC6030107
18

Mlynarcik P, Roderova M, Kolar M. Primer evaluation for PCR and its application for detection of carbapenemases in Enterobacteriaceae. Jundishapur J Microbiol 2016;9:e29314.

10.5812/jjm.2931427099689PMC4834133
19

Schechner V, Straus-Robinson K, Schwartz D, Pfeffer I, Tarabeia J, Moskovich R, et al. Evaluation of PCR-based testing for surveillance of KPC-producing carbapenem-resistant members of the Enterobacteriaceae family. J Clin Microbiol 2009;47:3261-5.

10.1128/JCM.02368-0819675211PMC2756929
20

Tofteland S, Haldorsen B, Dahl KH, Simonsen GS, Steinbakk M, Walsh TR, et al. Effects of phenotype and genotype on methods for detection of extended-spectrum-beta-lactamase-producing clinical isolates of Escherichia coli and Klebsiella pneumoniae in Norway. J Clin Microbiol 2007;45:199-205.

10.1128/JCM.01319-0617079502PMC1828980
21

Pérez-Pérez FJ, Hanson ND. Detection of plasmid-mediated AmpC beta-lactamase genes in clinical isolates by using multiplex PCR. J Clin Microbiol 2002;40:2153-62.

10.1128/JCM.40.6.2153-2162.200212037080PMC130804
22

Bogdanovich T, Adams-Haduch JM, Tian GB, Nguyen MH, Kwak EJ, Muto CA, et al. Colistin-resistant, Klebsiella pneumoniae carbapenemase (KPC)-producing Klebsiella pneumoniae belonging to the international epidemic clone ST258. Clin Infect Dis 2011;53:373-6.

10.1093/cid/cir40121810751PMC3202324
23

Rojas LJ, Salim M, Cober E, Richter SS, Perez F, Salata RA, et al. Colistin resistance in carbapenem-resistant Klebsiella pneumoniae: Laboratory detection and impact on mortality. Clin Infect Dis 2017;64:711-8.

24

van Duin D, Doi Y. Outbreak of colistin-resistant, carbapenemase-producing Klebsiella pneumoniae: Are we at the end of the road? J Clin Microbiol 2015;53:3116-7.

10.1128/JCM.01399-1526202122PMC4572557
25

Marchaim D, Chopra T, Pogue JM, Perez F, Hujer AM, Rudin S, et al. Outbreak of colistin-resistant, carbapenem- resistant Klebsiella pneumoniae in metropolitan Detroit, Michigan. Antimicrob Agents Chemother 2011;55:593-9.

10.1128/AAC.01020-1021115786PMC3028794
26

Tóth A, Damjanova I, Puskás E, Jánvári L, Farkas M, Dobák A, et al. Emergence of a colistin-resistant KPC-2-producing Klebsiella pneumoniae ST258 clone in Hungary. Eur J Clin Microbiol Infect Dis 2010;29:765-9.

10.1007/s10096-010-0921-320401676
27

Ko KS. Antibiotic-resistant clones in Gram-negative pathogens: presence of global clones in Korea. J Microbiol 2019;57:195-202.

10.1007/s12275-019-8491-230552629
28

Livermore DM. Current epidemiology and growing resistance of gram-negative pathogens. Korean J Intern Med 2012;27:128-42.

10.3904/kjim.2012.27.2.12822707882PMC3372794
29

Yoo JS, Kim HM, Yoo JI, Yang JW, Kim HS, Chung GT, et al. Detection of clonal KPC-2-producing Klebsiella pneumoniae ST258 in Korea during nationwide surveillance in 2011. J Med Microbiol 2013;62:1338-42.

10.1099/jmm.0.059428-023741020
30

Cheong HS, Kim SY, Seo J, Wi YM, Peck KR, Ko KS. Colistin resistance and extensive genetic variations in PmrAB and PhoPQ in Klebsiella Pneumoniae isolates from South Korea. Curr Microbiol 2020;77:2307-11.

10.1007/s00284-020-02074-432524274
31

Jaidane N, Bonnin RA, Mansour W, Girlich D, Creton E, Cotellon G, et al. Genomic insights into colistin-resistant Klebsiella pneumoniae from a Tunisian Teaching Hospital. Antimicrob Agents Chemother 2018;62:e01601-17.

10.1128/AAC.01601-1729229634PMC5786813
페이지 상단으로 이동하기