Original Article

JOURNAL OF BACTERIOLOGY AND VIROLOGY. 31 December 2025. 310-326
https://doi.org/10.4167/jbv.2025.55.4.310

ABSTRACT


MAIN

INTRODUCTION

Helicobacter pylori (H. pylori) is a gram-negative, spiral-shaped bacterium that grows under microaerobic or capnophilic environment (1, 2, 3, 4, 5). It colonizes the gastric mucosa by adhering to the epithelial surface and exhibits remarkable adaptability that enables long-term persistence (6, 7). The strong urease activity and motility of H. pylori is advantageous to survive in the gastric mucosa (8, 9, 10, 11, 12, 13). In particular, urease-mediated neutralization of gastric acid by H. pylori induces hyperacidity and mucosal injury (14, 15), leading to persistent inflammation, which in turn can cause acute or chronic gastritis, peptic ulcers, and gastric cancers in humans (16, 17, 18, 19).

Dendritic cells (DCs) are not only responsible for initiating adaptive immune responses but also serve as key antigen-presenting cells that determine the overall direction of the immune response. Upon recognition of H. pylori, naïve DCs internalize the bacterium and undergo maturation, leading to antigen presentation and T-cell activation (20). Responding to the immune reaction of DCs, H. pylori modulates the immune response of DCs to evade the immune clearance through various mechanisms, thereby establishing chronic infection (20, 21). Indeed, mature DCs secrete IL-1β and IL-6, which promote the differentiation of Th17 cells (21, 22, 23). These DCs may also induce Th1 immune responses characterized by the production of IFN-γ, MHC II molecules, and IL-12α (22, 24). On the other hand, H. pylori skewed the immune responses of DCs to induce the expression of TGF-β and the transcription factor FoxP3, thereby facilitating the differentiation of regulatory T cells (Tregs), which produce IL-10 and suppress Th1-mediated inflammation. Thus, DC-mediated antigen presentation in H. pylori infection can lead to divergent immunological outcomes, ranging from inflammatory clearance via Th17/Th1 pathways to immune tolerance mediated by Tregs (25, 26, 27).

Most clinical isolates of H. pylori grow poorly in vitro and are difficult to use in in vivo models such as mice or Mongolian gerbils, as the bacteria is typically adapted to human gastric mucosa (28, 29). Infection susceptibility varies by mouse strain and H. pylori genotype (30). Although the mouse-adapted Sydney Strain 1 (SS1) is widely used (31, 32), its genome has not been fully annotated, limiting its utility for genomic or epidemiological studies. Previous work identified two clinical isolates—H. pylori 51 strain (Hp51) and H. pylori (Hp52)—that successfully infect experimental mice (33). Proteomic analyses revealed increased expression of urease and catalase in Hp52, and upregulation of ATP-dependent protease binding subunits in Hp51, suggesting that differential protein expression contributes to varying infectivity across isolates. Hp51 (Accession CP000012.1) and Hp52 (Accession CP001680.1), isolated in Korea from gastric cancer and peptic ulcer patients, were fully sequenced and deposited in GenBank. In contrast, H. pylori strains 26695 (Hp26695) and J99 (HpJ99), despite having published genome sequences (34, 35), showed very low level of infectivity in mice and are therefore used primarily for in vitro studies.

To understand strain-specific infectivity, we asked two central questions: (i) why do H. pylori strains differ in their ability to infect mice, and (ii) what bacterial factors determine infectivity? To answer this question, it is necessary to perform a comparative analysis of gene expression among H. pylori strains with differing levels of infectivity, in order to construct a gene library of candidates suspected to contribute to the differences in infectivity. Additionally, the functional roles of each gene in the immune response to H. pylori must be elucidated.

A major barrier to answering these questions is the technical difficulty of genetically manipulating H. pylori. Knockout (K/O) strains are generated by inserting antibiotic resistance markers such as chloramphenicol resistance (cat) or kanamycin resistance (aphA-3) into open reading frames (ORFs) via cross-over PCR (36). However, compared with E. coli, H. pylori requires stringent growth conditions, and standard natural transformation or electroporation methods are often ineffective (37, 38). To overcome these barriers, improved transformation and culturing methods need to be employed. H. pylori transformation efficiency was improved by modifying growth supplements and optimizing the timing of DNA exposure under established culture conditions (38, 39). Growth of H. pylori typically requires supplementation with bovine or horse serum (40, 41, 42), and environmental factors such as cell division rate, temperature, supply level of O2 or CO2, and nutrient availability strongly influence bacterial adaptation and colonization (43). Essential growth factors—including dextrose, sodium chloride, and glucose—support survival in the gastric environment (44, 45, 46, 47). As H. pylori divides more slowly than E. coli or the resident gastric microbiota (48), exogenous nutrient supplementation such as Albumin–Dextrose–Saline (ADS) is required, similar to Mycobacterium spp. (49, 50). Therefore, ADS was used as a serum substitute to enhance the transformation efficiency of H. pylori.

In this study, we compared the gene expression profiles of H. pylori strains Hp52, Hp26695, and HpJ99—which exhibit distinct levels of infectivity in mice—using microarray analysis, and constructed a gene library comprising candidates presumed to contribute to these differences in infectivity. To investigate the immunological roles of these genes during H. pylori–host interactions, we generated individual gene-K/O mutants and analyzed DC immune responses to these mutants in mice. Through this approach, we aimed to identify genes associated with the infectivity-related immune modulation in H. pylori.

MATERIALS AND METHODS

Culture of H. pylori

All H. pylori strains were provided by Fastidious Specialized Pathogen Resources Bank of Gyeongsang National University Hospital (Korea). Hp52 was isolated from a gastric cancer patient and possesses infectivity in mice. In contrast, the standard strains used in the experiment, Hp26695 and HpJ99, do not possess infectivity in mice. Half-thawed H. pylori stocks were inoculated onto Brucella agar plates (MP Biomedicals, Korea) supplemented with 10% horse serum (Gibco, USA) and incubated at 37°C under a microaerophilic atmosphere containing 10% CO₂ for 48 h. Following primary isolation, the bacteria were subcultured in the growth medium for at least three consecutive passages at 24 h intervals. The cultured medium was reinoculated into 3 mL of fresh medium and incubated for 16 h using the thin-layer liquid culture method (39).

Microarray analysis using H. pylori total RNA

Total RNA was extracted from cultured H. pylori using the TRIzolTM total RNA extraction kit (ThermoFisher, USA), and microarray analysis was performed (Genomictree Inc., Korea). Total RNA was quantified and amplified using Agilent’s Low RNA Input Linear Amplification Kit PLUS (Agilent, USA), and subsequently labeled by the addition of 0.5 μL of Cyanine 3-CTP (Cy3) according to the manufacturer’s instructions. Hybridization was carried out for 17 h at 65°C using Agilent’s Gene Expression Hybridization Kit (Agilent, USA). The Cy3-hybridized samples were scanned using the SureScan Microarray Scanner (Agilent, USA), and fluorescence signals were extracted using Agilent’s Feature Extraction Software. In this study, Hp52 was used as the reference strain. For each gene, probe recognition was achieved by aligning to a 120 bp region beginning at the N-terminus of the mRNA. Whole-genome clustering of H. pylori genes was performed using Agilent’s GeneSpring Software (Agilent, USA). Differential gene expression between Hp52, Hp26695, and HpJ99 was assessed, and genes exhibiting statistically significant changes were identified using an ANOVA t-test.

Verification of microarray results

All genes that showed significantly different expression in Hp26695 and HpJ99 compared to the Hp52 in the microarray analysis were verified using quantitative real-time RT-PCR (qRT-PCR) . The nucleotide sequences of selected target genes, along with the housekeeping gene (16S rRNA), were retrieved from GenBank (https://www.ncbi.nlm.nih.gov/genbank/). Primer sequences were designed using the NCBI Primer-BLAST tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) and PrimerSelect® (DNASTAR, USA). Total RNA was extracted from cultured H. pylori using the TRIzol™ Reagent (Invitrogen, USA). Complementary DNA (cDNA) was synthesized using the GoScript™ Reverse Transcription System (Promega, USA) with the following thermal cycling conditions: 5 min at 25°C, 1 h at 42°C, and 15 min at 70°C. qRT-PCR was performed with 2× SsoFast EvaGreen Supermix (Bio-Rad, USA) and 10 pmol/μL of primers specific to either the 16S rRNA housekeeping gene or the target gene using Rota-Gene Q (Qiagen, USA).

Construction of Gene K/O Mutants

Genes that showed differential expression in the microarray analysis and qRT-PCR validation were further examined using NCBI’s BLAST (Basic Local Alignment Search Tool). For each selected gene within the Hp52 genome registered in NCBI, the corresponding nucleotide regions were edited using sequence-manipulation software, including Lasergene (DNASTAR, USA) and SnapGene (GSL Biotech LLC, USA). Approximately 20 bp at the N-terminal region of each target gene were defined as the upstream flanking sequence, whereas 20–25 bp at the C-terminal region were designated as the downstream recognition sequence. All designed sequences were adjusted to achieve a G/C content of 35–50%. The N-terminal non-coding region of each gene, spanning 30–70 bp from the start codon, was selected to generate gene-specific mutant fragments of approximately 200 bp. A kanamycin-resistance (KMr) marker was inserted into the open reading frame (ORF) of each gene. The forward primer for the KMr cassette was positioned downstream of the upstream flanking sequence, whereas the reverse primer for the KMr cassette was positioned upstream of the downstream recognition sequence. K/O constructs were generated by sequential PCR using a cross-over assembly strategy. The flanking regions and the KMr cassette were assembled using two alternative approaches. In the direct-assembly method, the upstream and downstream flanking sequences were combined with the mutant fragment and the KMr cassette in a single PCR reaction to produce the complete K/O construct. Alternatively, the components were amplified as separate segments: a left-arm fragment consisting of the upstream flanking sequence fused to the KMr cassette, and a right-arm fragment consisting of the KMr cassette fused to the downstream flanking sequence. These fragments were then joined during a final assembly step. The resulting K/O constructs, generated either by direct assembly or by combining the left- and right-arm segments, were subsequently used for natural transformation of H. pylori.

PCR Conditions for Amplification and Assembly of K/O Constructs

PCR amplification of the upstream and downstream flanking fragments was carried out using an initial denaturation at 94°C for 5 min, followed by 30 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s, with a final extension at 72°C for 7 min. These flanking fragments were generated using a Taq polymerase pre-mix kit (BIONEER, Korea). Amplification of the KMr cassette was performed using a Pfu polymerase kit (ELPIS Biotech, Korea) with an initial denaturation at 94°C for 5 min, followed by 30 cycles of 94°C for 30 s, 52°C for 30 s, and 72°C for 90 s, and a final extension at 72°C for 7 min. All mutant fragments and KMr cassettes were assembled using a cross-over PCR method, as illustrated in Supplementary Fig. 1. Final amplification of the K/O constructs was performed using Taq DNA polymerase with an initial denaturation at 94°C for 5 min, followed by 25 cycles of 94°C for 40 s, 60°C for 40 s, and 72°C for 2 min. The sequences of all primers used in this study are listed in Table 1.

https://cdn.apub.kr/journalsite/sites/jbv/2025-055-04/N0290550403/images/JBV_2025_v55n4_310_f001.jpg
Fig. 1

Whole genome cluster of H. pylori using microarray analysis. A, Comparison of up- or down-regulation in gene expression between H. pylori 52 and 26695; B, Clustering of H. pylori 52 and HpJ99. The statistical significance of expression was determined by ANOVA t-test.

Table 1.

Primers information for amplifying knockout construct

Target gene Primers label Oligonucleotide sequence (5' → 3') Accession No. Function Location Amplicon size (bp) Assembled construct size (bp) Purpose of study
HPKB0346 0346 UF CAAAAAGCAAGAAGAAACCCAACG ACX98955.1 Hypothetical protein 351,536-351,767 251 1,751 Knock-out for transformation
0346 UR ATGGTTCGCTGGGTTTATCCCCGTCTTGTCAGCATAAAC
0346 DF TTACTGGATGAATTGTTTTAGTACCAAGCCCGTATTTCAATCAAGTG 352,041-352,249 234
0346 DR CTCTTAGGCTCTTCTCTGTTGGC
0346 ex F AAGTGGGGCGTGATTGTC 351,360-352,437 1,078 2,115 Sequence analysis
0346 ex R CTACACCCCTACCCTATAAAACAC
HPKB0407 0407 UF ACCCTTTTTGTAGTCATAATGTTTTGG ACX99015.1 Acetyl-CoA synthetase 417,447-417,657 230 1,622 Knock-out for transformation
0407 UR ATGGTTCGCTGGGTTTATCTCGTCTGATTGCATTGCATC
0407 DF TTACTGGATGAATTGTTTTAGTACCGGAAGAGTGAAATCTAAAAAACG 415,381-415,481 126
0407 DR AGCGTCCTTACACTTTATGAGAGAG
0407 ex F AAAACCCCCAAACACTTCA 415,176-417,852 2,677 2,022 Sequence analysis
0407 ex R CAAAACAAACAAATGGCTAGGCA
HPKB0424 0424 UF AAGACTTGATCGTTTATGAGCCG ACX99032.1 Hypothetical protein 433,154-433,343 255 2,004 Knock-out for transformation
0424 UR ATGGTTCGCTGGGTTTATCCCCCTAAAAAACAACAAAAAAC
0424 DF TTACTGGATGAATTGTTTTAGTACCGCGTTTTAACCTGAATGAAG 433,790-434,156 392
0424 DR GCCAAAAGGACAAAAACACCAG
0424 ex F TGTTTAGCATAGAGCAGAGC 432,983-434,327 1,345 2,255 Sequence analysis
0424 ex R AGGAAAATATCAGCATGAAAAGA
aldald UF AGATACCCAATCGTTTAATGGAGTGA ACX99978.1 Alanine dehydrogenase 1,504,248-1,504,381 153 1,851 Knock-out for transformation
ald UR ATGGTTCGCTGGGTTTATCCCACATCATCAGGCACTAAAGC
ald DF TTACTGGATGAATTGTTTTAGTACCTATCACCCAAGAAGGCATCG 1,505,379-1,505,694 341
ald DR CTTTTCGCAGTTTTCTTCTGTCCAT
ald ex F TACAAAAAGCCCGGTGCCAA 1,504,020-KM(r) R Null 1,672 Sequence analysis
aphA-3 KM(r) F GATAAACCCAGCGAACCAT AAA98050.1 Kanamycin resistance protein 199-1,402 1,401 Null Selective marker
KM(r) R GGTACTAAAACAATTCATCCAGTAA

Targeted Gene K/O via Natural Transformation

Natural transformation of H. pylori was performed using Brucella agar supplemented with 10% ADS enrichment (composed of 5% bovine serum albumin fraction V, 2% dextrose, and 0.85% sodium chloride). Hp52 cultured in liquid medium for 24 h was harvested and adjusted to a final absorbance of OD₆₀₀ = 1.0 (3.8 × 10⁸ CFU/mL). A 20µL aliquot of the bacterial suspension was spotted, without smearing, onto Brucella agar with ADS enrichment. The agar plates were pre-incubated at 37°C under 10% CO₂ for 12 h to allow bacterial adaptation. Linearized K/O constructs (1 µg in 10 µL) were then applied directly onto the pre-incubated H. pylori spots. After which, the bacterial cells were gently smeared within an approximate 10-mm diameter area and incubated under standard microaerophilic conditions to permit natural transformation.

Bone marrow–derived dendritic cells and infection assay for H. pylori mutants

Bone marrow–derived dendritic cells (BMDCs) were isolated from 6–7-week-old C57BL/6 mice (Koatech, Korea). Bone marrow cells were suspended in RPMI 1640 medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS; MP Biomedicals, USA) and 1% penicillin–streptomycin (Gibco, USA). BMDC differentiation was induced by culturing the cells in RPMI 1640 containing 10% FBS, 10 ng/mL GM-CSF (PeproTech, Korea), and 5 ng/mL IL-4 (PeproTech, Korea). The cell suspension was seeded into T75 flasks (Corning, USA) at 10 mL per flask and incubated for 5 days at 37°C in a 5% CO₂ atmosphere, with medium changes performed every 2 days. Fresh GM-CSF and IL-4 were added at identical concentrations during each medium replacement. Differentiated BMDCs were adjusted to a density of 1 × 10⁶ cells/mL in T75 flasks with 10 mL of medium and were allowed to rest for 4 h at 37°C with 5% CO₂. Hp52 and mutant strains derived from Hp52 were added at a multiplicity of infection (MOI) of 10 and incubated with BMDCs for 6 h under the same conditions. GAPDH was used as the endogenous control gene. Expression levels of 11 cytokine- and activation-related genes—including TGF-β, IFN-γ, CCR7, MHC class II, IL-1β, IL-6, IL-10, IL-12α, CD40, CD80, and CD86—were quantified in Hp52–pulsed and mutant-pulsed BMDCs using Rota-Gene Q (Qiagen). Ct values were obtained using Rotor-Gene Q Series Software (Qiagen), and relative expression levels were compared across experimental groups by the 2-ΔΔCT method using the house-keeping gene, GAPDH. All animal experiments were conducted in accordance with the guidelines of the Gyeongsang National University Institutional Animal Care and Use Committee (IACUC) and were approved by the committee (protocol number: GNU-210901-M0074-01).

RESULTS

Differential gene expression profiles among Hp52, Hp26695, and HpJ99

All microarray analyses were performed using H. pylori RNA samples that met quality thresholds of OD₂₆₀/₂₈₀ ≥ 1.8 and OD₂₆₀/₂₃₀ ≥ 1.6. A total of 1,432 genes were detected across strains Hp52, Hp26695, and HpJ99 (Fig. 1). Comparative transcriptomic analysis between Hp52 and Hp26695 identified 21 genes that exhibited ≥2-fold expression changes across all probes. In the comparison between Hp52 and HpJ99, 41 genes demonstrated ≥2-fold differential expression. Among the significantly altered genes, 5 genes exhibited >5-fold down-regulation in Hp26695 compared to the Hp52. In strain HpJ99, 15 genes were down-regulated by >5-fold, excluding non-coding regions, compared to the Hp52 (Table 2). Notably, 2 genes—HPKB0424 (hypothetical protein) and HPKB1443 (ald)—showed commonly reduced expression in both Hp26695 and HpJ99. HPKB0424 and ald were down-regulated by 5.23-fold and 11.59-fold, respectively, in Hp26695, and by 24.12-fold and 22.77-fold, respectively, in HpJ99. In addition, 4 genes were identified that were not expressed in the HpJ99, including HPKB0346 (Hypothetical protein), HPKB0407 (Acetyl-CoA synthetase), HPKB0914 (Hypothetical protein), and HPKB1145 (Hypothetical protein) (Table 2).

Table 2.

Expression information of H. pylori classified through microarray analysis

Versus each strain Probe label Protein tag Gene name Gene location Size (bp) Characterization Fold change
26695 vs 52 chpT0402 HPKB0424 hypothetical protein 433,344-433,841 498 - 5.23
chpT0836 HPKB0871 hypothetical protein 921,120-920,821 300 - 28.35
chpT0890 HPKB0932 glyQ 987,108-986,212 897 glycyl-tRNA synthetase subunit alpha 141.36
chpT1058 HPKB1116 HPKB1116 1,183,574-1,182,195 1,380 MATE efflux family protein, putative 40.45
chpT1373 HPKB1443 ald 1,504,312-1,505,454 1,143 Alanine dehydrogenase 11.59
J99 vs 52 chpT0007 HPKB0012 hopZ 7,434-5,287 2,148 Outer membrane protein HopZ; K15845 outer membrane protein HopZ 37.88
chpT0056 HPKB0060 HPKB0060 62,710-61,643 1,068 Cytosine specific DNA methyltransferase (DDEM) 15.22
chpT0324 HPKB0346 hypothetical protein sensibility 375 - 84.09
chpT0326 Non-coding region Non-coding region 352,641-353,025 385 - 39.36
chpT0377 HPKB0398- HPKB0399- HPKB0400 hypothetical protein-minC-lpxC 408,538-409,191 654 hypothetical protein - probable septum site-determining protein - UDP-3-O-(3-hydroxymyristoyl) N-acetylglucosamine deacetylase 75.70
chpT0385 HPKB0407 HPKB0407 417,460-415,472 1,989 Acetyl-CoA synthetase 110.40
chpT0394 HPKB0416 folK 427,033-427,524 492 7,8-Dihydroxymethylpterin-pyrophosphokinase 30.87
chpT0402 HPKB0424 hypothetical protein 433,344-433,841 498 - 24.12
chpT0469 HPKB0493 HPKB0493 510,014-509,037 978 Guanosine 5’-Monophosphate oxidoreductase 48.70
chpT0593 HPKB0623 HPKB0623 636,567-637,553 987 Transcriptional regulator 15.54
chpT0875 HPKB0914 hypothetical protein 973,337-973,636 300 - 179.63
chpT1080 HPKB1144 HPKB1144 1,213,169-1,212,180 990 Type II adenine specific DNA methyltransferase 30.37
chpT1081 HPKB1145 hypothetical protein 1,213,684-1,213,178 507 - 168.46
chpT1082 Non-coding region Non-coding region 1,213,859-1,213,656 204 - 121.55
chpT1140 HPKB1202 HPKB1202 1,264,891-1,267,425 2,535 NADH dehydrogenase subunit G 62.32
chpT1342 HPKB1413 HPKB1413 1,462,226-1,462,579 354 Dihydroneopterin aldolase 108.35
chpT1373 HPKB1443 ald 1,504,312-1,505,454 1,143 Alanine dehydrogenase 22.77

Confirmation of expression reproducibility using real-time qRT-PCR

Validation of microarray results was performed based on the 16S rRNA–normalized expression levels using qRT-PCR. When compared with Hp52, consistent differential expression patterns were observed in Hp26695 and HpJ99. The expression of HPKB0424 was reduced by 4.03-fold in Hp26695 and by 7.83-fold in HpJ99 relative to Hp52 (p < 0.001). HPKB1443 (ald, encoding alanine dehydrogenase) also showed significantly decreased expression, with 2.45-fold and 3.04-fold reductions in Hp26695 and HpJ99, respectively (p < 0.001). Among the genes not expressed in HpJ99, HPKB0407 exhibited a 0.96-fold decrease in Hp26695, although the change was not statistically significant. In contrast, HPKB0346 showed a non-significant 0.70-fold increase in Hp26695. Based on these findings, four genes—HPKB0346, HPKB0407, HPKB0424, and ald—were identified as candidates displaying reproducible expression patterns across both microarray and RT-qPCR analyses or lacking detectable expression in HpJ99 (Fig. 2).

https://cdn.apub.kr/journalsite/sites/jbv/2025-055-04/N0290550403/images/JBV_2025_v55n4_310_f002.jpg
Fig. 2

Relative gene expression by 2-ΔΔCt analysis of target genes using quantitative real-time RT-PCR. The target genes of H. pylori 26695 and J99 were compared with that of H. pylori 52. 16S-rRNA was used as a housekeeping gene. Statistical significance was measured by Student-t test.

Production of recombinant knock-out constructs

The K/O constructs incorporated the KMr cassette aphA-3 (1,401 bp). Four final assemblies were generated: ΔHPKB0346, ΔHPKB0407, ΔHPKB0424, and ΔHPKB1443 (Δald). The ΔHPKB0346 construct consisted of a 251 bp upstream fragment and a 234 bp downstream fragment, yielding a total assembly size of 1,751 bp. The ΔHPKB0407 construct was composed of a 230 bp upstream fragment and a 126 bp downstream fragment, with a final size of 1,622 bp. The ΔHPKB0424 construct included a 255 bp upstream fragment and a 392 bp downstream fragment, resulting in a total size of 2,004 bp. The Δald construct contained a 153 bp upstream fragment and a 341 bp downstream fragment, with a total size of 1,851 bp. Successful amplification and assembly of each K/O construct were verified by agarose gel electrophoresis (Supplementary Fig. 2).

Comparison of cytokine expression levels using 2-ΔΔCt analysis

Cytokine gene expressions in Hp52–pulsed DCs and K/O mutant–pulsed DCs were quantified using the 2−ΔΔCt method (Fig. 3). Relative to DCs pulsed with wild-type Hp52, IFN-γ expression was significantly reduced in all mutant groups, with fold-decreases of 1.47 (ΔHPKB0346), 1.76 (ΔHPKB0407), 1.89 (ΔHPKB0424), and 1.48 (Δald). MHC class II expression was also decreased in DCs pulsed with ΔHPKB0407 (2.36-fold), ΔHPKB0424 (2.72-fold), and Δald (2.23-fold) compared to the Hp52–pulsed DCs. Expression of IL-1β, IL-6, and IL-10 was down-regulated in DCs stimulated with ΔHPKB0346 (IL-1β: 2.08-fold; IL-6: 1.84-fold; IL-10: 4.44-fold), ΔHPKB0407 (IL-1β: 2.13-fold; IL-6: 1.42-fold; IL-10: 4.47-fold), and ΔHPKB0424 (IL-1β: 2.02-fold; IL-6: 2.22-fold; IL-10: 5.54-fold). CD40 expression was reduced in DCs pulsed with ΔHPKB0346 (1.69-fold), ΔHPKB0407 (1.74-fold), and ΔHPKB0424 (1.92-fold), while CD80 expression was decreased in DCs stimulated with ΔHPKB0346 (1.18-fold), ΔHPKB0407 (1.41-fold), and Δald (0.78-fold). In contrast, DCs pulsed with the Δald mutant exhibited marked increases in IL-1β (1.94-fold), IL-6 (2.62-fold), and IL-10 (2.38-fold) compared to the wild-type–pulsed DCs.

https://cdn.apub.kr/journalsite/sites/jbv/2025-055-04/N0290550403/images/JBV_2025_v55n4_310_f003.jpg
Fig. 3

Comparison of immune responses to H. pylori-pulsed DCs via 2-ΔΔCtanalysis. Specimen standard was compared with H. pylori 52-pulsed DCs, and GAPDH was used as a housekeeping gene. Statistical significance was measured by Student-t test.

DISCUSSION

H. pylori possess numerous virulence determinants that contribute to its ability to establish colonization and persist within the gastrointestinal tract. Several factors have been implicated in infection establishment and inflammatory responses, including the well-characterized cytotoxin-associated gene A (CagA) and vacuolating cytotoxin A (VacA), both of which are strongly associated with bacterial colonization and the risk of gastric cancer development (51, 52, 53, 54, 55). Additional virulence factors such as alpA, babA2, and hopZ have also been reported(56, 57, 58). These factors are thought to enhance colonization efficiency and promote infection-associated pathology (58); however, many factors that influence the establishment of infection have yet to be identified.

In this study, we aimed to identify virulence-associated genes involved in the establishment of H. pylori infection and the corresponding host immune responses. A comparative microarray analysis was conducted to examine global gene expression differences among three H. pylori strains—Hp52, which exhibits high infectivity in mice, and the less infectious strains Hp26695 and HpJ99. Four genes showing pronounced differential expression or presence–absence variation were identified. To investigate the contribution of these genes to colonization establishment, K/O mutants were generated in the Hp52 background. By assessing the immune responses of mouse BMDCs to each mutant, we inferred the functional roles of the selected genes in the establishment of H. pylori colonization.

Relative to strains Hp26695 and HpJ99, the Hp52 strain exhibited elevated expression or unique possession of four genes: HPKB1443 (ald), HPKB0346, HPKB0407, and HPKB0424. Among these, HPKB0407 encodes acetyl-CoA synthetase (ACS), which was absent in HpJ99. ACS is a key enzyme involved in acetate metabolism and TCA cycle function (59, 60). Although acetyl-CoA carboxylase (ACC) has been suggested to influence H. pylori growth under CO₂-enriched conditions (61), the role of ACS in H. pylori pathogenesis has not been previously demonstrated. Given their metabolic similarities, ACS may perform functions analogous to ACC, providing a potential explanation for its contribution to bacterial growth and infectivity. HPKB1443 encodes alanine dehydrogenase (Ald), an oxidoreductase that catalyzes the reversible deamination of L-alanine using NAD⁺ or NADP⁺ (62). In Bacillus subtilis, Ald is required for spore formation (63), and in Mycobacterium spp., it is secreted extracellularly and supports chronic persistence under nutrient-limited conditions (64, 65), making it a potential therapeutic target (66). These findings collectively suggest that ald may contribute to the establishment of chronic H. pylori infection.

Although the functions of HPKB0346 and HPKB0424 remain unknown, both were found to influence bacterial growth, as their respective K/O mutants exhibited slower proliferation than the wild-type strain. Moreover, the reduced growth rates observed in all K/O mutants indicate that the differentially expressed genes identified in Hp52 contribute to bacterial colonization within the host (Supplementary Fig. 3). Previous studies have highlighted the importance of colonization efficiency in H. pylori infectivity (45, 46, 47, 48), yet the factors governing successful colonization remain poorly defined. Our results suggest that loss of any of these genes impairs colonization and proportionally reduces infectivity.

Dendritic cells (DCs) play a pivotal role in initiating and navigating immune responses to H. pylori, and therefore can be used in studies investigating H. pylori infection pathogenesis (24, 67). IFN-γ, although not the principal cytokine produced by bacteria-pulsed DCs, contributes to bacterial clearance (68, 69, 70, 71). In this study, DCs pulsed with any of the four K/O strains showed reduced IFN-γ expression compared with wild-type Hp52–pulsed DCs. In addition, pulsing with ΔHPKB0407, ΔHPKB0424, or Δald DCs resulted in decreased MHC class II expression, suggesting that these gene products function as important immunogenic antigens. Consistent with this, expression of the DC activation markers CD40 and CD80 was reduced in DCs stimulated with the K/O strains.

Interestingly, DCs exposed to ΔHPKB0346, ΔHPKB0407, and ΔHPKB0424 displayed reduced expression of IL-1β, IL-6, and IL-10, whereas Δald-pulsed DCs exhibited increased expression of these cytokines. These results imply that HPKB0346, HPKB0407, and HPKB0424 likely serve as major antigens that promote pro-inflammatory or Th17-type responses (27, 72, 73, 74, 75). Conversely, Ald appears to play a distinct immunomodulatory role, potentially promoting tolerogenic DC function. Given that H. pylori infection is known to shift the Th17/Treg balance toward immune tolerance (72), the increased IL-1β and IL-6 expression induced by the Δald mutant suggests that ald is involved in immune evasion mechanisms of H. pylori. In several bacterial pathogens, Ald has been implicated in metabolic adaptation under nutrient-limited or host-associated conditions, contributing to redox homeostasis and persistence (63, 64, 65). In H. pylori, ald-mediated metabolic regulation may similarly influence bacterial physiology in ways that indirectly modulate host immune responses. One possible mechanism is that Ald-dependent control of intracellular redox balance and amino acid metabolism affects the production or release of bacterial metabolites that act as immunomodulatory signals (76, 77). As mentioned above, Ald is a central metabolic enzyme that catalyzes the reversible conversion of L-alanine to pyruvate (62), and metabolic byproducts generated through alanine–pyruvate metabolism could influence host innate immune signaling pathways, including NF-κB activation and inflammasome-associated cytokines such as IL-1β (78, 79). Consistent with this notion, deletion of ald resulted in enhanced expression of IL-1β and IL-6 in dendritic cells, suggesting that Ald activity in the wild-type strain may normally dampen pro-inflammatory DC activation. However, it remains to be determined whether the increase in IL-10 expression in DCs pulsed by the Δald mutant represents a negative feedback response to heightened pro-inflammatory signaling such as increased IL-1β and IL-6 levels. Nevertheless, given the decreased IL-10 expression in DCs exposed to ΔHPKB0346, ΔHPKB0407, and ΔHPKB0424 mutants, it is plausible that the increased IL-10 expression in Δald-pulsed DCs is a result of negative feedback mechanisms responding to the elevated IL-1β and IL-6 levels (80, 81).

Through transcriptomic comparison and functional analysis of K/O strains, we identified four genes—ald, HPKB0346, HPKB0407, and HPKB0424—that contribute to bacterial growth rate and immune modulation. Notably, ald exhibited a unique role in altering DC immune responses, potentially facilitating chronic infection. Understanding the potential gene determinants that shape the immunological behavior of H. pylori may provide valuable insights for the development of vaccines or therapeutic strategies aimed at preventing or controlling H. pylori infection.

AUTHOR CONTRIBUTIONS

Jong-Hun Ha: Conceptualization, Methodology, Investigation, Formal analysis, Writing – original draft

Jin-Sik Park: Methodology, Investigation

Jeong-Gyu Cho: Methodology, Investigation, Visualization

Jeong-Ih Shin: Methodology, Investigation

Seorin Park: Methodology, Investigation

Dong-Chul Kim: Conceptualization, Formal analysis

Hyung-Lyun Kang: Data curation, Validation

Kee Woong Kwon: Validation

Seung Chul Baik: Resources

Min-Kyoung Shin: Investigation, Formal analysis

Myunghwan Jung: Conceptualization, , Investigation, Supervision, Funding acquisition, Writing – original draft

Woo-Kon Lee: Conceptualization, , Investigation, Supervision, Funding acquisition, Writing – review & editing

FUNDING

This research was supported by the National Culture Collection for Pathogens (NCCP) R&D project of the Ministry of Health & Welfare (2016-ER4701, and 2022ER250300) and National Research Foundation of Korea (NRF) grants funded by the Korean government (2019R1I1A3A01059312 and 2021R1I1A3059179).

ETHICS STATEMENT

Not applicable.

CONFLICT OF INTEREST

The authors declare no competing interests.

Acknowledgements

All Helicobacter pylori strains used in the present study were kindly provided by Fastidious Specialized Pathogen Resources Bank (a member of the National Culture Collection for Pathogens, Gyeongsang National University Hospital, Jinju, Korea).

References

1

Bury-Mone S, Kaakoush NO, Asencio C, Me´graud F, Thibonnier M, De Reuse H, et al. Is Helicobacter pylori a True Microaerophile? Helicobacter. 2006;11(4):296-303.

10.1111/j.1523-5378.2006.00413.x
2

Rhee KH, Park JS, Cho MJ. Helicobacter pylori: bacterial strategy for incipient stage and persistent colonization in human gastric niches. Yonsei Med J. 2014;55(6):1453-1466.

10.3349/ymj.2014.55.6.145325323880PMC4205683
3

Öztekin M, Yılmaz B, Ağagündüz D, Capasso R. Overview of Helicobacter pylori Infection: Clinical Features, Treatment, and Nutritional Aspects. Diseases. 2021;9(4):66.

10.3390/diseases904006634698140PMC8544542
4

Sun Q, Yuan C, Zhou S, Lu J, Zeng M, Cai X, et al. Helicobacter pylori infection: a dynamic process from diagnosis to treatment. Front Cell Infect Microbiol. 2023;13:1257817.

10.3389/fcimb.2023.125781737928189PMC10621068
5

Ranjbar R, Behzadi P, Farshad S. Advances in diagnosis and treatment of Helicobacter pylori infection. Acta Microbiol Immunol Hung. 2017;64(3):273-292.

10.1556/030.64.2017.008
6

Alzahrani S, Lina TT, Gonalez J, Pinchuk IV, Beswick EJ, Reyes VE. Effect of Helicobacter pylori on gastric epithelial cells. World J Gastroenterol. 2014;20(36):12767-12780.

10.3748/wjg.v20.i36.1276725278677PMC4177462
7

Percival SL, Suleman L. Biofilms and Helicobacter pylori: Dissemination and persistence within the environment and host. World J Gastroenterol. 2014;5(3):122-132.

10.4291/wjgp.v5.i3.12225133015PMC4133512
8

Dunn BE, Phadnis SH. Structure, Function and Localization of Helicobacter pylori Urease. Yale J Biol Med. 1998;71(2):63-73.

9

Pérez-Pérez GI, Gower CB, Blaser MJ. Effects of Cations on Helicobacter pylori Urease Activity, Release, and Stability. Infect Immun. 1994;62(1):299-302.

10.1128/iai.62.1.299-302.19948262643PMC186100
10

Shaalan H, Azrad M, Peretz A. The effect of three urease inhibitors on H. pylori viability, urease activity and urease gene expression. Front Microbiol. 2024;15:1464484.

10.3389/fmicb.2024.146448439619692PMC11604635
11

O’Toole PW, Lane MC, Porwollik S. Helicobacter pylori motility. Microbes Infect. 2000;2(10):1207-1214.

10.1016/S1286-4579(00)01274-0
12

Gu H. Role of Flagella in the Pathogenesis of Helicobacter pylori. Curr Microbiol. 2017;74(7):863-869.

10.1007/s00284-017-1256-428444418PMC5447363
13

Nakajima K, Inatsu S, Mizote T, Nagata Y, Aoyama K, Fukuda Y, et al. Possible involvement of putA gene in Helicobacter pylori colonization in the stomach and motility. Biomed Res. 2008;29(1):9-18.

10.2220/biomedres.29.9
14

Bury-Moné S, Skouloubris S, Labigne A, De Reuse H. The Helicobacter pylori UreI protein: role in adaptation to acidity and identification of residues essential for its activity and for acid activation. Mole Microbiol. 2001;42(4):1021-1034.

10.1046/j.1365-2958.2001.02689.x
15

Olivera-Severo D, Wassermann GE, Carlini CR. Ureases display biological effects independent of enzymatic activity. Is there a connection to diseases caused by urease-producing bacteria? Braz J Med Biol Res. 2006;39(7):851-861.

10.1590/S0100-879X2006000700002
16

Malfertheiner P, Camargo MC, El-Omar E, Liou JM, Peek R, Schulz C, et al. Helicobacter pylori infection. Nat Rev Dis Primers. 2024;9(1):19.

10.1038/s41572-023-00431-837081005PMC11558793
17

Graham DY. History of Helicobacter pylori, duodenal ulcer, gastric ulcer and gastric cancer. World J Gastroenterol. 2014;20(18):5191-5204.

10.3748/wjg.v20.i18.519124833849PMC4017034
18

Kucukazman M, Yeniova O, Dal K, Yavuz B. Helicobacter pylori and cardiovascular disease. Eur Rev Med Pharmacol Sci. 2015;19(19):3731-3741.

19

Sachs G, Wen Y, Scott DR. Gastric Infection by Helicobacter pylori. Curr Gastroenterol Rep. 2009;11(6):455-461.

10.1007/s11894-009-0070-y19903421PMC4492511
20

Blosse A, Lehours P, Wilson KT, Gobert AP. Helicobacter: Inflammation, immunology, and vaccines. Helicobacter. 2018;23(1):e12517.

10.1111/hel.1251730277626PMC6310010
21

Jang AR, Kang MJ, Shin JI, Kwon SW, Park JY, Ahn JH, et al. Unveiling the Crucial Role of Type IV Secretion System and Motility of Helicobacter pylori in IL-1β Production via NLRP3 Inflammasome Activation in Neutrophils. Front Immunol. 2020;11:1121.

10.3389/fimmu.2020.0112132582201PMC7295951
22

Larussa T, Leone I, Suraci E, Imeneo M, Luzza F. Helicobacter pylori and T Helper Cells: Mechanisms of Immune Escape and Tolerance. J Immunol Res. 2015;2015:981328.

10.1155/2015/98132826525279PMC4615206
23

Dixon BREA, Hossain R, Patel RV, Algood HMS. Th17 Cells in Helicobacter pylori Infection: a Dichotomy of Help and Harm. Infect Immun. 2019;87(11):e00363-19.

10.1128/IAI.00363-1931427446PMC6803329
24

Wang YH, Govel JP, Chu YT, Wu JJ, Lei HY. Helicobacter pylori Impairs Murine Dendritic Cell Responses to Infection. PLoS ONE. 2010;5(5):e10844.

10.1371/journal.pone.001084420523725PMC2877707
25

Salavati S, Ahmadi Hedayati M, Ahmadi A, Fakhari S, Jalili A. Relationship between Helicobacter pyloricagA Genotypes Infection and IL‑10 and TGFβ1 Genes’ Expression in Gastric Epithelial Cells. Int J Prev Med. 2020;11:20.

10.4103/ijpvm.IJPVM_536_1832175060PMC7050228
26

Orertli M, Müller A. Helicobacter pylori targets dendritic cells to induce immune tolerance, promote persistence and confer protection against allergic asthma. Gut Microbes. 2012;3(6):566-571.

10.4161/gmic.2175022895083PMC3495795
27

Maleki Kakelar H, Barzegari A, Dehghani J, Hanifian S, Saeedi N, Barar J, et al. Pathogenicity of Helicobacter pylori in cancer development and impacts of vaccination. Gastric Cancer. 2019;22(1):23-36.

10.1007/s10120-018-0867-1
28

Ogura K, Maeda S, Nakao M, Watanabe T, Tada M, Kyutoku T, et al. Virulence Factors of Helicobacter pylori Responsible for Gastric Diseases in Mongolian Gerbil. J Exp Med. 192(11):1601-1609.

10.1084/jem.192.11.160111104802PMC2193104
29

Chen D, Stenstrom B, Zhao CM, Wadstrom T. Does Helicobacter pylori infection per se cause gastric cancer or duodenal ulcer? Inadequate evidence in Mongolian gerbils and inbred mice. FEMS Immunol Med Microbiol. 2007;50(2):184-189.

10.1111/j.1574-695X.2007.00249.x
30

Taylor NS, Fox JG. Animal Models of Helicobacter-Induced Disease: Methods to Successfully Infect the Mouse. Methods Mol Biol. 2012;921:131-142.

10.1007/978-1-62703-005-2_1823015501PMC3545442
31

Thompson LJ, Danon SJ, Wilson JE, O’Rourke JL, Salama NR, Falkow S, et al. Chronic Helicobacter pylori Infection with Sydney Strain 1 and a Newly Identified Mouse-Adapted Strain (Sydney Strain 2000) in C57BL/6 and BALB/c Mice. Infect Immun. 2004;72(8):4668-4679.

10.1128/IAI.72.8.4668-4679.200415271928PMC470698
32

Akada JK, Ogura K, Dailidiene D, Dailide G, Cheverud JM, Berg DE. Helicobacter pylori tissue tropism: mouse-colonizing strains can target different gastric niches. Microbiology. 2003;149(pt 7):1901-1909.

10.1099/mic.0.26129-0
33

Lee KJ, Kim BR, Cho YA, Song YG, Song JY, Lee KH, et al. Comparison of Proteome Components of Helicobacter pylori Before and After Mouse Passage. J Bacteriol Virol. 2011;41(4):267-278.

10.4167/jbv.2011.41.4.267
34

Faghri J, Poursina F, Moghim S, Zarkesh Esfahani H, Nasr Esfahani B, Fazeli H, et al. Morphological and Bactericidal Effects of Different Antibiotics on Helicobacter pylori. Jundishapur J Microbiol. 2014;7(1):e8704.

10.5812/jjm.870425147656PMC4138673
35

Woo J, Bang CS, Lee JJ, Ahn JY, Kim JM, Jung HY, et al. In Vitro Susceptibility and Synergistic Effect of Bismuth Against Helicobacter pylori. Antibiotics(Basel). 2024;13(11):1004.

10.3390/antibiotics1311100439596699PMC11591412
36

Gorrell RJ, Yang J, Kusters JG, van Vliet AH, Robins-Browne RM. Restriction of DNA encoding selectable markers decreases the transformation efficiency of Helicobacter pylori. FEMS Immunol Med Microbiol. 2005;44(2):213-219.

10.1016/j.femsim.2004.10.019
37

Ando T, Xu Q, Torres M, Kusugami K, Israel DA, Blaser MJ. Restriction-modification system differences in Helicobacter pylori are a barrier to interstrain plasmid transfer. Mol Microbiol. 2000;37(5):1052-1065.

10.1046/j.1365-2958.2000.02049.x
38

Moore ME, Lam A, Bhatnagar S, Solnick JV. Environmental Determinants of Transformation Efficiency in Helicobacter pylori. J Bacteriol. 2014;196(2):337-344.

10.1128/JB.00633-1324187089PMC3911246
39

Joo JS, Park KC, Song JY, Kim DH, Lee KJ, Kwon YC, et al. A Thin-Layer Liquid Culture Technique for the Growth of Helicobacter pylori. Helicobacter. 2010;15(4):295-302.

10.1111/j.1523-5378.2010.00767.x
40

Shibayama K, Nagasawa M, Ando T, Minami M, Wachino J, Suzuki S, et al. Usefulness of Adult Bovine Serum for Helicobacter pylori Culture Media. J Clin Microbiol. 2006;44(11): 4255-4257.

10.1128/JCM.00477-0616957036PMC1698367
41

Morshed MG, Karita M, Konishi H, Okita K, Nakazawa T. Growth Medium Containing Cyclodextrin and Low Concentration of Horse Serum for Cultivation of Helicobacter pylori. Microbiol Immunol. 1994;38(11):897-900.

10.1111/j.1348-0421.1994.tb02143.x
42

Jiang X, Doyle MP. Growth Supplements for Helicobacter pylori. J Clin Microbiol. 2000;38(5):1984-1987.

10.1128/JCM.38.5.1984-1987.2000
43

Lagier JC, Edouard S, Pagnier I, Mediannilkov O, Drancourt M, Raoult D. Current and Past Strategies for Bacterial Culture in Clinical Microbiology. Clin Microbiol Rev. 2015;28(1):208-236.

10.1128/CMR.00110-1425567228PMC4284306
44

Sheu SM, Cheng H, Kao CY, Yang YJ, Wu JJ, Sheu BS. Higher glucose level can enhance the H. pylori adhesion and virulence related with type IV secretion system in AGS cells. J Biomed Sci. 2014;21(1):96.

10.1186/s12929-014-0096-925296847PMC4196111
45

Gancz H, Jones KR, Merrell DS. Sodium Chloride Affects Helicobacter pylori Growth and Gene Expression. J Bacteriol. 2008;190(11):4100-4105.

10.1128/JB.01728-0718375562PMC2395038
46

Dunne C, Dolan B, Clyne M. Factors that mediate colonization of the human stomach by Helicobacter pylori. World J Gastroenterol. 2014;20(19):5610-5624.

10.3748/wjg.v20.i19.561024914320PMC4024769
47

Scott D, Weeks D, Melchers K, Sachs G. The life and death of Helicobacter pylori. Gut 1998;43(Suppl 1):S56-S60.

10.1136/gut.43.2008.S56
48

Nitharwal RG, Verma V, Dasgupta S, Dhar SK. Helicobacter pylori chromosomal DNA replication: Current status and future perspectives. FEBS Lett. 2011;585(1):7-17.

10.1016/j.febslet.2010.11.018
49

Kim MJ, Kim KM, Shin JI, Ha JH, Lee DH, Choi JG, et al. Identification of Nontuberculous Mycobacteria in Patients with Pulmonary Diseases in Gyeongnam, Korea, Using Multiplex PCR and Multigene Sequence-Based Analysis. Can J Infect Dis Med Microbiol. 2021;2021:8844306.

10.1155/2021/884430633688383PMC7920741
50

Franzblau SG, DeGroote MA, Cho SH, Andries K, Nuermberger E, Orme IM, et al. Comprehensive analysis of methods used for the evaluation of compounds against Mycobacterium tuberculosis. Tuberculosis(Edinb). 2012;92(6):453-488.

10.1016/j.tube.2012.07.003
51

Hatakeyama M. Helicobacter pylori CagA and Gastric Cancer: A Paradigm for Hit-and-Run Carcinogenesis. Cell Host Microbe. 2014;15(3):306-316.

10.1016/j.chom.2014.02.008
52

Nilsson C, Sillén A, Eriksson L, Strand ML, Enroth H, Normark S, et al. Correlation between cag Pathogenicity Island Composition and Helicobacter pylori-Associated Gastroduodenal Disease. Infect Immun. 2003;71(11):6573-6581.

10.1128/IAI.71.11.6573-6581.200314573679PMC219608
53

Terry CE, McGinnis LM, Madigan KC, Cao P, Cover TL, Liechti GW, et al. Genomic Comparison of cag Pathogenicity Island (PAI)-Positive and-Negative Helicobacter pylori Strains: Identification of Novel Markers for cag PAI-Positive Strains. Infect Immun. 2005;73(6):3794-3798.

10.1128/IAI.73.6.3794-3798.200515908415PMC1111835
54

Fischer W. Assembly and molecular mode of action of the Helicobacter pylori Cag type IV secretion apparatus. FEBS J. 2011;278(8):1203-1212.

10.1111/j.1742-4658.2011.08036.x
55

Takahashi-Kanemitsu A, Knight CT, Hatakeyama M. Molecular anatomy and pathogenic actions of Helicobacter pylori CagA that underpin gastric carcinogenesis. Cell Mol Immunol. 2020;17(1):50-63.

10.1038/s41423-019-0339-531804619PMC6952403
56

Senkovich OA, Yin J, Ekshyyan V, Conant C, Traylor J, Adegboyega P, et al. Helicobacter pylori AlpA and AlpB Bind Host Laminin and Influence Gastric Inflammation in Gerbils. Infect Immun. 2011;79(8):3106-3116.

10.1128/IAI.01275-1021576328PMC3147585
57

Bartpho TS, Wattanawongdon W, Tongtawee T, Paoin C, Kangwantas K, Dechsukhum C. Precancerous Gastric Lesions with Helicobacter pylorivacA+/babA2+/oipA+ Genotype Increase the Risk of Gastric Cancer. BioMed Res Int. 2020;2020:7243029.

10.1155/2020/724302932149129PMC7049835
58

Lee DH, Ha JH, Shin JI, Kim KM, Choi JG, Park S, et al. Increased Risk of Severe Gastric Symptoms by Virulence Factors vacAs1c, alpA, babA2, and hopZ in Helicobacter pylori Infection. J Microbiol Biotechnol. 2021;31(3):368-379.

59

Ikeda Y, Yamamoto J, Okamura M, Fujino T, Takahashi S, Takeuchi K, et al. Transcriptional Regulation of the Murine Acetyl-CoA Synthetase 1 Gene through Multiple Clustered Binding Sites for Sterol Regulatory Element-binding Proteins and a Single Neighboring Site for Sp1. J Biol Chem. 2001;276(36):34259-34269.

10.1074/jbc.M103848200
60

Schwer B, Bunkenborg J, Verdin RO, Andersen JS, Verdin E. Reversible lysine acetylation controls the activity of the mitochondrial enzyme acetyl-CoA synthetase 2. Proc Natl Acad Sci U S A. 2006;103(27):10224-10229.

10.1073/pnas.060396810316788062PMC1502439
61

Burns BP, Hazell SL, Mendz GL. Acetyl-CoA carboxylase activity in Helicobacter pylori and the requirement of increased CO2 for growth. Microbiology(Reading). 1995;141 ( Pt 12):3113-3118.

10.1099/13500872-141-12-3113
62

Gu P, Ma Q, Zhao S, Li Q, Gao J. Alanine dehydrogenases from four different microorganisms: characterization and their application in L-alanine production. Baotechnol Biofuels Bioprod.2023;16(1):123.

10.1186/s13068-023-02373-537537629PMC10401832
63

Siranosian KJ, Ireton K, Grossman AD. Alanine Dehydrogenase (ald) Is Required for Normal Sporulation in Bacillus subtilis. J Bacteriol. 1993;175(21):6789-6796.

10.1128/jb.175.21.6789-6796.19938226620PMC206802
64

Tripathi SM, Ramachandran R. Crystal structures of the Mycobacterium tuberculosis secretory antigen alanine dehydrogenase (Rv2780) in apo and ternary complex forms captures ‘‘open’’ and ‘‘closed’’ enzyme conformations. Proteins. 2008;72(3):1089-1095.

10.1002/prot.22101
65

Betts JC, Lukey PT, Robb LC, McAdam RA, Duncan K. Evaluation of a nutrient starvation model of Mycobacterium tuberculosis persistence by gene and protein expression profiling. Mole Microbiol. 2002;43(3):717-731.

10.1046/j.1365-2958.2002.02779.x
66

Hasan S, Daugelat S, Rao PS, Schreiber M. Prioritizing Genomic Drug Targets in Pathogens: Application to Mycobacterium tuberculosis. PLos Comput Biol. 2006;2(6):e61.

10.1371/journal.pcbi.002006116789813PMC1475714
67

Fehling M, Drobbe L, Moos V, Renner Viveros P, Hagen J, Beigier-Bompadre M, et al. Comparative Analysis of the Interaction of Helicobacter pylori with Human Dendritic Cells, Macrophages, and Monocytes. Infect Immun. 2012;80(8):2724-2734.

10.1128/IAI.00381-1222615251PMC3434561
68

Rahman F. Characterizing the immune response to Mycobacterium tuberculosis: a comprehensive narrative review and implications in disease relapse. Front Immunol. 2024;15:1437901.

10.3389/fimmu.2024.143790139650648PMC11620876
69

Murphey ED, Fang G, Varma TK, Sherwood ER. Improved bacterial clearance and decreased mortality can be induced by LPS tolerance and is not dependent upon IFN-γ. SHOCK 2007;27(3):289-295.

10.1097/01.shk.0000245024.93740.28
70

Bao S, Beagley KW, France MP, Shen J, Husband AJ. Interferon-γ plays a critical role in intestinal immunity against Salmonella typhimurium infection. Immunology. 2000;99(3):464-472.

10.1046/j.1365-2567.2000.00955.x10712678PMC2327174
71

Sayi A, Kohler E, Hitzler I, Arnold I, Schwendener R, Rehrauer H, et al. The CD4+ T Cell-Mediated IFN-γ Response to Helicobacter Infection Is Essential for Clearance and Determines Gastric Cancer Risk. J Immunol. 2009;182(11):7085-7101.

10.4049/jimmunol.0803293
72

Kao JY, Zhang M, Miller MJ, Mills JC, Wang B, Liu M, et al. Helicobacter pylori immune escape is mediated by dendritic cell-induced Treg skewing and Th17 suppression in mice. Gastroenterology. 2010;138(3):1046-1054.

10.1053/j.gastro.2009.11.04319931266PMC2831148
73

Serlli-Lee V, Ling KL, Ho C, Yeong LH, Lim GK, Ho B, et al. Persistent Helicobacter pylori Specific Th17 Responses in Patients with Past H. pylori Infection Are Associated with Elevated Gastric Mucosal IL-1β. PLoS ONE. 2012;7(6):e39199.

10.1371/journal.pone.003919922761739PMC3382622
74

Nakase H, Sato N, Mizuno N, Ikawa Y. The influence of cytokines on the complex pathology of ulcerative colitis. Autoimmun Rev. 2022;21(3):103017.

10.1016/j.autrev.2021.103017
75

Guglani L, Khader SA. Th17 cytokines in mucosal immunity and inflammation. Curr Opin HIV AIDS. 2010;5(2):120-127.

10.1097/COH.0b013e328335c2f620543588PMC2892849
76

Mills EL, Kelly B, O’Neill LAJ. Mitochondria are the powerhouses of immunity. Nat Immunol. 2017;18(5):488-498.

10.1038/ni.3704
77

Kawai T, Akira S.Signaling to NF-kB by Toll-like receptors. Trends Mol Med. 2007;13(11):460-469.

10.1016/j.molmed.2007.09.002
78

Hosseinkhani F, Heinken A, Thiele I, Lindenburg PW, Harms AC, Hankemeier T. The contribution of gut bacterial metabolites in the human immune signaling pathway of non-communicable diseases. Gut Microbes. 2021;13(1):1-22.

10.1080/19490976.2021.188292733590776PMC7899087
79

Gasaly N, Vos P, Hermoso MA. Impact of Bacterial Metabolites on Gut Barrier Function and Host Immunity: A Focus on Bacterial Metabolism and Its Relevance for Intestinal Inflammation. Front Immunol. 2021;12:658354.

10.3389/fimmu.2021.65835434122415PMC8187770
80

Nikaein N, Tuerxun K, Cedersund G, Eklund D, Kruse R, Särndahl E, et al. Mathematical models disentangle the role of IL-10 feedbacks in human monocytes upon proinflammatory activation. J Biol Chem. 2023;299(10):105205.

10.1016/j.jbc.2023.10520537660912PMC10556785
81

Fucikova J, Palova-Jelinkova L, Bartunkova J, Spisek R. Induction of Tolerance and Immunity by Dendritic Cells: Mechanisms and Clinical Applications. Front Immunol. 2019;10:2393.

10.3389/fimmu.2019.0239331736936PMC6830192

SUPPLEMENTARY DATA

SUPPLEMENTARY DATA

https://cdn.apub.kr/journalsite/sites/jbv/2025-055-04/N0290550403/images/JBV_2025_v55n4_310_f004.jpg
Supplementary Fig. 1

The strategy for constructing knock-out of the target genes using cross-over PCR technique.

https://cdn.apub.kr/journalsite/sites/jbv/2025-055-04/N0290550403/images/JBV_2025_v55n4_310_f005.jpg
Supplementary Fig. 2

Confirmation of knockout constructs and mutant clones of H. pylori 52. (A) PCR products of knockout constructs. (B) PCR products of H. pylori 52 knockout single clone or clones mix. Description of lanes: (M) 1kb+ marker (A) upstream product (B) kanamycin resistance from pBHP489K (C) downstream product (AB) left fragment (BC) right fragment (ABC) final assembly 1 (direct assembly) (AB,BC) final assembly 2 (left and right assembly) (CL) left fragment from single clone (ML) left fragment from clones mix (LC) left fragment control (CR) right fragment from single clone (MR) right side from clones mix (RC) right fragment control (CH) target gene from single clone (MH) target gene from clones mix (FA) final assembly control (N.C.) antibiotics marker non-included target gene (Negative control).

https://cdn.apub.kr/journalsite/sites/jbv/2025-055-04/N0290550403/images/JBV_2025_v55n4_310_f006.jpg
Supplementary Fig. 3

The growth kinetics of the H. pylori 52 strain and its knockout mutants. The growth rates were evaluated by measuring optical density (OD) following inoculation. All mutants exhibited reduced growth rates compared to the wild-type strain H. pylori 52, confirming that deletion of the selected genes impaired bacterial proliferation. Statistical significance was measured by Student-t test.

페이지 상단으로 이동하기