Original Article

JOURNAL OF BACTERIOLOGY AND VIROLOGY. 30 June 2020. 97-106
https://doi.org/10.4167/jbv.2020.50.2.097

ABSTRACT


MAIN

  • INTRODUCTION

  • MATERIALS AND METHODS

  •   Bacterial strains and culture conditions

  •   Construction of the deletion mutant ∆anoI

  •   Growth curves

  •   Biofilm formation assay

  •   Motility test

  •   Quantitative real-time PCR analysis

  •   Data analysis and statistics

  • RESULTS

  •   Confirmation of the anoI-deletion mutant

  •   Effects of exogenous AHLs on anoR expression

  •   Biofilm formation and motility tests

  •   Expression of csuC, csuD and pilT

  • DISCUSSION

  • Conclusions

INTRODUCTION

The genus Acinetobacter is a genetically multifarious group of aerobic, Gram negative, and non-fermentative bacteria found in numerous healthcare environments (1). Acinetobacter nosocomialis belonging to the Acinetobacter calcoaceticus-baumannii community is an opportunistic nosocomial pathogen (2). Its invasive and non-invasive diseases have been extensively studied in various nosocomial contexts, although previous studies suggest that this bacterium might be less virulent than its closely related counterpart, A. baumannii. The pathogenic mechanism that allows A. baumannii to thrive in the environment is the formation of a biofilm through attachment to both biotic and abiotic surfaces, which initiates processes that protect against various factors and enable the bacteria to survive in healthcare environments (3). Communal behaviors of bacteria, such as virulence, biofilm formation and motility, are often modulated by regulating target gene expression via the quorum sensing (QS) system (4).

One of the best-known QS systems is the LuxI/LuxR two-component system (TCS) of Vibrio harveyi(5). Autoinducer, N-acyl-homoserine lactones (AHLs) of V. harveyi is synthesized by AHL synthase, LuxI using two substrates, S-adenosylmethionine (SAM) and an acylated acyl carrier protein (ACP). At a minimum threshold level, AHLs bind to the N-terminal region of LuxR and leads to form LuxR homodimers, which enables to regulate transcription of the target genes by binding to specific DNA sequences and thereby regulate transcription of the target genes. AnoI/AnoR is known as LuxI/LuxR homologous in A. nosocomialis (6, 7). Prior studies have reported AnoI/AnoR complex is responsible for up- or down-regulation of several target genes through AHLs mediated TCS.

Previous studies have reported that the QS system is involved in the biofilm-formation process and exogenous AHLs promote or inhibit biofilm formation in other bacterial strains (8). Biofilm formation is one of the major defense mechanisms that allow bacteria to withstand challenging environmental niches and survive (9). Biofilm development is a multistep process involving initial attachment, irreversible attachment, maturation, and dispersion (10, 11). Accumulation of bacterial cells internally in an extracellular matrix enables the bacteria to form a self-protecting growth pattern, prominently comprising exopolymers (EPs), which facilitate adherence to the solid surface (12, 13). Thus, understanding about the mechanism by which the QS system contributes to biofilm development could be beneficial in eradicating the infection at the initial stage, underscoring the importance of identifying effective ways to target biofilm formation by this pathogenic bacterium.

In our previous study, we demonstrated that AHLs are secreted by A. nosocomialis and exert a significant influence on biofilm and pellicle formation (7). In the current study, we constructed an anoI-deletion mutant of A. nosocomialis to further investigate the regulatory roles of the AHLs, C6-HSL, C10-HSL and C12-HSL, in biofilm formation and motility in A. nosocomialis. Here, we report the C12-HSL is the most prominent AHL, which plays a major role in regulating biofilm and motility in A. nosocomialis, whereas C6HSL and C10HSL may act as regulators in modulating other phenotypes through the QS mechanism.

MATERIALS AND METHODS

Bacterial strains and culture conditions

The bacterial strains and plasmid used in this study are listed in Table 1. Wild-type (WT) A. nosocomialis (ATCC 17903) was obtained from American Type Culture Collection (ATCC; VA, USA) and an anoI-deletion mutant (∆anoI) was constructed as a previously described method (7). All bacterial strains were grown in Luria-Bertani (LB) medium at 37°C. AHLs were exogenously added to the WT and anoI-deletion mutant as dictated by specified experimental requirements. Synthetic N-hexanoyl-homoserine lactone (C6-HSL), N-decanoyl-homoserine lactone (C10-HSL), and N-(3-hydroxy-dodecanoyl)- homoserine lactone (C12-HSL) were purchased from Sigma-Aldrich (St. Louis, MO, USA).

Table 1.

Bacterial strains and plasmid used in this study

Strains and plasmids Relevant characteristicsa Reference/source
A. nosocomialis ATCC17903 Type strain (14)
∆anoIA. nosocomialis derivative, ∆anoI::Kmr This study
DH5α λ pir Plasmid replication Laboratory collection
S17-l λ pir Conjugal donor Laboratory collection
pUC4K pUC4 with nptI; Apr, Kmr Laboratory collection
pHKD01 pDS132, multicloning sites; oriR6K, sacB, Cmr(15)
pOH01 pHKD01 with ∆anoI::nptI; Cmr, Kmr This study
aKmr, kanamycin resistant; Apr, ampicillin resistant; Cmr, chloramphenicol resistant

Construction of the deletion mutant ∆anoI

The anoI-deletion mutant was created from the A. nosocomialis WT strain by amplification of a DNA fragment following disruption of the open reading frame (ORF) of the target gene using an overlap extension-polymerase chain reaction (OE-PCR) method and a pair of specific primers, as listed in Table 2. Amplification of the mutated DNA fragment without the anoI gene was accomplished in two PCR steps using four PCR primers specific to upstream and downstream regions (~1 kb) of the coding region of anoI. To combine upstream and downstream regions of anoI with nptI (conferring kanamycin resistance) by overlap extension PCR, we designed ANOI02F and ANOI02R primers for amplification of the upstream region so as to contain an additional 25 nucleotides at their 5’ end homologous to the downstream region and nptI(7). The fragments were amplified using A. nosocomialis WT genomic DNA. The resulting fragments were then mixed in equimolar amounts and again subjected to OE-PCR with specific primers. The resulting 3.1-kb DNA fragment was ligated into a FspI-digested pHKD01 vector to generate pOH01. The E. coli S17-1 strain harboring the pOH01 was used as a conjugal donor for transferring the plasmid to A. nosocomialis ATCC 17903. Transconjugants were created and isolated using a previously described method (15). Briefly, the donor and recipient strains were grown in LB until the optical density at 600 nm (OD600) 0.8. The strains were mixed in equal ratio and spotted onto LB plate followed by incubation at 30 ℃ for 12 h. The bacteria were resuspended in LB broth and then plated on LB agar plates containing specific antibiotics to eliminate the donor strain and to select the merodiploid cells. The merodiploids were plated on LB agar containing 10% sucrose to excise the plasmid with the antibiotic resistance cassette from the chromosome. The deletion of the anoI gene was confirmed by PCR analysis.

Table 2.

Oligonucleotides used in this study

Oligonucleotide Sequence (5´→3´)a,b Target
For gene deletion in A. nosocomialis
ANOI01F TTTCTGAAGCCTTTAAGGTTGTT anoI
ANOI01R TACAAGTGCTTCCACTTATTTTTAATG
ANOI02F TTAAAAATAAGTGGAAGCACTTGTATGGTTTAAAGGTTAACTCTTGTCTCTC
ANOI02R GCAACACCTTCTTCACGAGGCAGACAGGATTTTGGGGAAGTTTGC
For deleted gene confirmation
AnoI-F CTAATATTATTGGCTGTGCC
AnoI-R TCTACGGCTGAAAATCTTGA
For qRT-PCR analysisFunctions
16S RNA_F CGTGCTACAATGGTCGGT 16S ribosomal RNA
16S RNA_R GTATTCACCGCGGCATTC
anoI_qRT_F GCTTATGTGGTCGCTCAAGATAG AHLs binding gene
anoI_qRT_R ACTGAGCCAACCGACATTT
anoR_qRT_F GACCCTACTGTGCATTG AHLs receptor gene
anoR_qRT_R ACTGAGCCCAACCGACATTT
csuC_qRT_F GTCAGTCCACAACAATGACA pili structure gene
csuC_qRT_R ACAACACATAGCCGAAAGCA
csuD_qRT_F ACTGTTCCAACGAAACGCAA Pili structure gene
csuD_qRT_R CGTCGGGTTAAATCGACACC
pilT_qRT_F ATGTCCATCGCCTCGTTTAT Biofilm and motility gene
pilT_qRT_R GCAACATTCGGTACTTCAAA
aThe oligonucleotides were designed using the A. nosocomialis ATCC17903 (GenBank Accession No. GCA_000248315.2) genome sequences
bRegions of oligonucleotides not complementary to the corresponding templates are underlined.

Growth curves

A. nosocomialis WT and the anoI-deletion mutant were cultivated in LB broth overnight and diluted into the main cultures at a ratio of 1:100. The diluted cultures were incubated at 37°C, and optical density at 600 nm (OD600) was measured at specific time points of incubation up to 24 h.

Biofilm formation assay

Biofilm formation was performed as previously described with slight modifications (7). Briefly, overnight subcultures of A. nosocomialis WT and anoI-deletion mutant were adjusted to an OD600 of 1, after which 50 μl was added to 5 ml of Mueller-Hinton (MH) medium in round-bottom polystyrene tubes (17´ 100 mm). The setup was incubated at 30°C without shaking for 48 h, then the pellicle formed in tubes was removed and the culture was carefully discarded without disturbing the biofilm attached to the surface of the tube. After air-drying tubes, 5 ml of 0.1% (w/v) crystal violet was added for 15 min to stain the biofilm, after which tubes were washed with sterile water and the crystal violet-stained biofilm was re-solubilized in 1 ml of 30% acetic acid. A 200-ml sample of the solution was then transferred to a 96-well microtiter plate and the absorbance in each sample at 595 nm was measured. Each experiment was independently repeated five times.

Motility test

Surface motility was examined on Mueller Hinton (MH) medium containing 0.25% Eiken soft agar (Eiken Chemical, Tokyo, Japan). A. nosocomialis WT and anoI-deletion mutant cultivated in MH broth overnight were diluted to adjust the OD600 to 1, and 5 μl of each sample was spotted onto the center of the motility plate, with (40 μM) or without exogenous AHLs. The plates were then incubated at 30°C for 18 h. Motility on the agar surface was observed and compared. Plates were prepared fresh for each surface motility experiment, and the test was repeated on at least three separate occasions.

Quantitative real-time PCR analysis

Overnight subcultures of A. nosocomialis WT and anoI-deletion mutant were added to 10 ml of LB medium with (40 or 80 μM) and without AHLs (C6-HSL, C10-HSL and C12-HSL) and incubated under steady-state culture conditions until the OD600 1.5. Total RNA was extracted using a High Pure RNA Isolation Kit (Roche Diagnostics GmbH, Germany) according to the manufacturer’s instructions. cDNA was synthesized from 1 mg of DNase-treated total RNA using Reverse Transcription Master Premix (Elpis Biotech Inc., Korea) as per the manufacturer’s instructions. Quantitative RT-PCR was performed using a Bio-Rad CFX Real-Time PCR system with Bio-Rad CFX Maestro software (Bio-Rad, Hercules, CA, USA) and the indicated primers (Table 2).

Data analysis and statistics

Data presented in this study represent the results from at least three independent experiments that yielded consistent results. The significance of differences between two groups was determined using unpaired Student’s t-test, and differences among more than three groups were evaluated using a one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison test using Graph-Pad Prism Software (ver.5.01; GraphPad Software, San Diego, CA, USA).

RESULTS

Confirmation of the anoI-deletion mutant

The anoI-deletion mutant was confirmed by PCR of anoI gene (Fig. 1A) using the primer sets AnoIF and AnoR. 0.2 Kb PCR product of anoI gene was detected from WT, whereas none from anoI mutant. To determine whether deletion of anoI affected the growth of A. nosocomialis, we compared the growth in LB broth (Fig. 1B). The kinetics of growth of the anoI-deletion mutant were not different from those of the WT, suggesting that growth of these bacterial cells is not dependent on the product of the anoI gene. We also found that anoI mRNA was not expressed in the anoI-deletion mutant, further confirming deletion of the anoI gene (Fig. 1C).

http://static.apub.kr/journalsite/sites/jbv/2020-050-02/N0290500203/images/Figure_jbv_50_02_03_F1.jpg
Fig. 1.

Confirmation of the anoI-deletion mutant. (A) Gel image showing PCR analysis of the WT and anoI-deletion mutant (∆anoI), confirming deletion of the target gene. (B) Representative growth curves for the WT and anoI-deletion mutant. (C) anoI mRNA expression was nearly absent in the anoI-deletion mutant. ***P < 0.001 versus WT.

Effects of exogenous AHLs on anoR expression

To study the impact of anoI-deletion in A. nosocomialis, we compared changes in the levels of anoR mRNA in the anoI-deletion mutant with those in the WT strain following treatment with different types of AHL. Under baseline conditions, expression of anoR mRNA was reduced in the anoI-deletion mutant compared with that in the WT strain, a finding clearly consistent with our previous report (7). However, exogenously applied AHLs especially 40 μM greatly stimulated the expression of anoR mRNA in the anoI-deletion mutant (Fig. 2A, B, C), hence, 40 μM was set as the standard concentration for subsequent experiments on AHLs in this study. When the mutant was incubated with 40 μM C6-HSL, C10-HSL, or C12-HSL, anoR expression was up-regulated at 1.3, 2.0, or 2.65 times compared to the untreated anoI mutant. The highest anoR expression difference was observed with C12-HSL (Fig. 2C).

http://static.apub.kr/journalsite/sites/jbv/2020-050-02/N0290500203/images/Figure_jbv_50_02_03_F2.jpg
Fig. 2.

Relative mRNA expression of anoR in the absence and presence of the indicated concentration (40 and 80 mM) and type of AHL. (A–D) anoR mRNA expression in the WT and anoI-deletion mutant following exposure to different concentrations of C6-HSL (A), C10-HSL (B) or C12-HSL (C). The differences among different sample groups were evaluated using a one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison test using Graph-Pad Prism Software. ***P < 0.001 versus the anoI-deletion mutant.

Biofilm formation and motility tests

To examine the effects of exogenous AHLs on biofilm formation in the anoI-deletion mutant, we employed crystal violet staining. Crystal violet staining showed reduced biofilm formation by the anoI-deletion mutant compared with the WT strain. Notably, addition of exogenous AHLs to the anoI-deletion mutant increased biofilm development, as shown in Fig. 3A. Quantification of biofilm formation indicated that the greatest increase occurred in the presence of exogenous C12-HSL, which restored biofilm-formation ability to WT levels. Although the treatment of C10 or C6-HSL enhance the biofilm formation of anoI-deletion mutant, relative levels of biofilm was lower than C12-HSL treated anoI-deletion mutant (Fig. 3B). To test motility, we spotted overnight cultures of A. nosocomialis WT and the anoI-deletion mutant onto MH medium containing 0.25% Eiken soft agar, with or without exogenous AHLs. Motility was restored in anoI-deletion mutants treated with C12-HSL. In contrast, C6-HSL and C10-HSL show no effect on the motility of the anoI-deletion mutant, possibly indicating that suppression of the motility phenotype may reflect a certain threshold activity of a particular AHL. To better understand this relationship, we combined C12-HSL with C6-HSL or C10-HSL, and observed that each combination restored motility, suggesting a synergistic effect of AHLs. These data indicate that C12-HSL is the predominant AHL type involve in biofilm formation and motility phenotypes in A. nosocomialis.

http://static.apub.kr/journalsite/sites/jbv/2020-050-02/N0290500203/images/Figure_jbv_50_02_03_F3.jpg
Fig. 3.

Biofilm formation and motility. (A) Crystal violet staining of biofilm formed by the WT or anoI-deletion mutant in the presence (40 μM) and absence of exogenous AHLs. (B) Graphical representation of biofilm formation, quantified as absorbance at OD590 nm. The differences among different sample groups were evaluated using a one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison test using Graph-Pad Prism Software. (C) Motility assay of the WT in the absence of exogenous AHLs and of the anoI-deletion mutant in both the absence and presence of AHLs. **P < 0.01 and ***P < 0.001 versus the anoI-deletion mutant.

Expression of csuC, csuD and pilT

To further understand the QS mechanism with respect to the genetic basis of biofilm formation and motility, we assessed the effects of exogenous AHLs on three biofilm related genes, csuC, csuD and pilT. The mRNA expression of these genes were significantly increased in anoI-deletion mutant treated with C6-, 10-, or C12-HSL compared to the mutant without AHLs. Among AHLs, C12-HSL induced the highest expression of csuC, csuD and pilT genes (Fig. 4). These data show that exogenous AHLs affect the expression of genes related to biofilm and motility and that C12-HSL is the most prominent QS molecule in A. nosocomialis.

http://static.apub.kr/journalsite/sites/jbv/2020-050-02/N0290500203/images/Figure_jbv_50_02_03_F4.jpg
Fig. 4.

Relative mRNA expression of various genes related to biofilm formation and motility. Expression of csuC, csuD and pilT genes in the WT and anoI-deletion mutant strain in the presence (40 μM) and absence of exogenous AHLs, measured by qRT-PCR. The differences among different sample groups were evaluated using a one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison test using Graph-Pad Prism Software. *P < 0.05, **P < 0.01 and ***P < 0.001 versus the anoI-deletion mutant.

DISCUSSION

In this study, we found that different types of AHLs differentially affect QS gene activity in the A. nosocomialis strain in an anoI-deleted setting, exerting effects on biofilm formation and motility. Previous studies have reported that when local AHL levels are high, AHLs diffuse back into cells, resulting in expression of the anoR gene (16). Hence, to study the regulation of biofilm formation and motility in A. nosocomialis, we used different types of AHLs—specifically, C6-HSL, C10-HSL and C12-HSL—that have been identified in other Acinetobacter strains. In this study, we found that expression of the anoR gene in the anoI-deletion mutant requires induction by exogenous AHLs (Fig. 2), with a concentration of 40 μM exerting the greatest stimulatory effect (17).

The QS system makes a major contribution to biofilm formation and motility, both of which are important virulence factors. In this study, biofilm formation was enhanced by addition of exogenous AHLs, with C12-HSL causing the greatest increase in biofilm formation. In the case of motility, only exogenous C12-HSL, or a combination of C12-HSL with other AHL types, restored motility (Fig. 3C) (18). The inability of C6-HSL and C10-HSL to support motility was correlated with their limited induction of csuC, csuD and pilT genes. These relationships may indicate that exogenous AHL types have an abrupt threshold below which they are unable to activate certain genes or operons to express a certain phenotype (19, 20).

It has been reported that genes such as csuC, csuD and pilT, are known to be involved in biofilm formation and motility. In the current study, these genes exhibited increased mRNA expression upon addition of exogenous AHLs in the QS-deficient mutant, ∆anoI (Fig. 4). This result is similar to that reported for Hafnia alvei and Sinorhizobium meliloti (8, 21), in which the QS genes, luxI and sinI, respectively, were deleted. Previous studies on the activity of AHLs in the QS system (8, 22, 23) reported that different AHLs may regulate different phenotypes in bacteria. We found that among the exogenous AHLs tested, the C12-HSL depicted increased mRNA expression of csuC, csuD and pilT genes in the anoI-deletion mutant (Fig. 4) indicating that C12-HSL could be the key AHL for biofilm and motility in A. nosocomialis.

Conclusions

The AHL-dependent QS system plays a significant role in biofilm formation and motility in A. nosocomialis. In this study, we showed that addition of exogenous AHLs to an A. nosocomialis strain lacking the QS gene, anoI, rescued the mutant phenotype and restored anoR expression levels. Among the different AHLs tested in this study, C12-HSL exerted a significant impact on biofilm formation and the expression of various biofilm and motility-related genes. Notably, C12-HSL was the only AHL that rescued motility in the anoI-deletion mutant strain, but the combination of C12-HSL with C6-HSL or C10-HSL was able to restore motility owing to possible synergistic effects of the AHLs. This suggests that the motility phenotype in A. nosocomialis might be regulated only by C12-HSL, as it may be the most abundant AHL produced by this bacterium. Further studies focusing on the regulation of AHLs in A. nosocomialis will be important in understanding the QS system, particularly as it relates to the potential to target anoI/R gene with QS inhibitors, as to design better strategies to control the spread of this infection in the environment.

Acknowledgements

This work was supported by research fund of Chungnam National University (2018).

.

CONFLICT OF INTEREST

Authors declare no conflict of interests in this paper

References

1
Qi C, Malczynski M, Parker M, Scheetz MH. Characterization of genetic diversity of carbapenem-resistant Acinetobacter baumannii clinical strains collected from 2004 to 2007. J Clin Microbiol 2008;46:1106-9.
10.1128/JCM.01877-0718216212PMC2268351
2
Wang X, Chen T, Yu R, Lü X, Zong Z. Acinetobacter pittii and Acinetobacter nosocomialis among clinical isolates of the Acinetobacter calcoaceticus-baumannii complex in Sichuan, China. Diagn Microbiol Infect Dis 2013;76:392-5.
10.1016/j.diagmicrobio.2013.03.02023639796
3
Peleg AY, Seifert H, Paterson DL. Acinetobacter baumannii: emergence of a successful pathogen. Clin Microbiol Rev 2008;21:538-82.
10.1128/CMR.00058-0718625687PMC2493088
4
Withers H, Swift S, Williams P. Quorum sensing as an integral component of gene regulatory networks in Gram-negative bacteria. Curr Opin Microbiol 2001;4:186-93.
10.1016/S1369-5274(00)00187-9
5
Bassler BL, Wright M, Showalter RE, Silverman MR. Intercellular signalling in Vibrio harveyi: sequence and function of genes regulating expression of luminescence. Mol Microbiol 1993;9:773-86.
10.1111/j.1365-2958.1993.tb01737.x8231809
6
Miller MB, Bassler BL. Quorum sensing in bacteria. Annu Rev Microbiol 2001;55:165-99.
10.1146/annurev.micro.55.1.16511544353
7
Oh MH, Choi CH. Role of LuxIR Homologue AnoIR in Acinetobacter nosocomialis and the Effect of Virstatin on the Expression of anoR Gene. J Microbiol Biotechnol 2015;25:1390-400.
10.4014/jmb.1504.0406925975610
8
Zhu YL, Hou HM, Zhang GL, Wang YF, Hao HS. AHLs Regulate Biofilm Formation and Swimming Motility of Hafnia alvei H4. Front Microbiol 2019;10:1330.
10.3389/fmicb.2019.0133031275267PMC6593095
9
Lee HW, Koh YM, Kim J, Lee JC, Lee YC, Seol SY, et al. Capacity of multidrug-resistant clinical isolates of Acinetobacter baumannii to form biofilm and adhere to epithelial cell surfaces. Clin Microbiol Infect 2008;14:49-54.
10.1111/j.1469-0691.2007.01842.x18005176
10
Armbruster CR, Parsek MR. New insight into the early stages of biofilm formation. Proc Natl Acad Sci USA 2018;115:4317-9.
10.1073/pnas.180408411529632199PMC5924939
11
Tolker-Nielsen T. Biofilm Development. Microbiol Spectr 2015;3:MB-0001-2014.
10.1128/microbiolspec.MB-0001-201426104692
12
Dunne WM Jr. Bacterial adhesion: seen any good biofilms lately? Clin Microbiol Rev 2002;15:155-66.
10.1128/CMR.15.2.155-166.200211932228PMC118072
13
Fux CA, Costerton JW, Stewart PS, Stoodley P. Survival strategies of infectious biofilms. Trends Microbiol 2005;13:34-40.
10.1016/j.tim.2004.11.01015639630
14
Nemec A, Krizova L, Maixnerova M, van der Reijden TJ, Deschaght P, Passet V, et al. Genotypic and phenotypic characterization of the Acinetobacter calcoaceticus-Acinetobacter baumannii complex with the proposal of Acinetobacter pittii sp. nov. (formerly Acinetobacter genomic species 3) and Acinetobacter nosocomialis sp. nov. (formerly Acinetobacter genomic species 13TU). Res Microbiol 2011;162:393-404.
10.1016/j.resmic.2011.02.00621320596
15
Oh MH, Lee JC, Kim J, Choi CH, Han K. Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii. Appl Environ Microbiol 2015;81:3357-68.
10.1128/AEM.03975-1425746991PMC4407223
16
Eberl L. N-acyl homoserinelactone-mediated gene regulation in gram-negative bacteria. Syst Appl Microbiol 1999;22:493-506.
10.1016/S0723-2020(99)80001-0
17
Saipriya K, Swathi CH, Ratnakar KS, Sritharan V. Quorum-sensing system in Acinetobacter baumannii: a potential target for new drug development. J Appl Microbiol 2020;128:15-27.
10.1111/jam.1433031102552
18
Rasmussen TB, Givskov M. Quorum sensing inhibitors: a bargain of effects. Microbiology 2006;152:895-904.
10.1099/mic.0.28601-016549654
19
Li Z, Nair SK. Quorum sensing: how bacteria can coordinate activity and synchronize their response to external signals? Protein Sci 2012;21:1403-17.
10.1002/pro.213222825856PMC3526984
20
Rémy B, Mion S, Plener L, Elias M, Chabrière E, Daudé D. Interference in Bacterial Quorum Sensing: A Biopharmaceutical Perspective. Front Pharmacol 2018;9:203.
10.3389/fphar.2018.0020329563876PMC5845960
21
Gurich N, González JE. Role of quorum sensing in Sinorhizobium meliloti-Alfalfa symbiosis. J Bacteriol 2009;191:4372-82.
10.1128/JB.00376-0919395488PMC2698488
22
Andersson RA, Eriksson AR, Heikinheimo R, Mäe A, Pirhonen M, Kõiv V, et al. Quorum sensing in the plant pathogen Erwinia carotovora subsp. carotovora: the role of expR (Ecc). Mol Plant Microbe Interact 2000;13:384-93.
10.1094/MPMI.2000.13.4.38410755301
23
Nasser W, Bouillant ML, Salmond G, Reverchon S. Characterization of the Erwinia chrysanthemi expI-expR locus directing the synthesis of two N-acyl-homoserine lactone signal molecules. Mol Microbiol 1998;29:1391-405.
10.1046/j.1365-2958.1998.01022.x9781877
페이지 상단으로 이동하기